Effect of the immunosuppressants on hepatocyte proliferation and apoptosis in a young animal model of liver regeneration: An immunohistochemical study using tissue microarrays

Hepatocyte proliferation and apoptosis (programmed cell death) occur during the liver parenchyma regeneration and the liver size modeling is mainly controlled by hepatocyte apoptosis. The purpose of the present study was to verify the influence of immunosuppressant drugs on these phenomena by utilizing tissue microarray techniques. Thirty-six weaning rats (age 21-23 days, weight 30-50 g) were divided into six groups: control, sham, hepatectomy, hepatectomy plus solumedrol, hepatectomy plus CsA, and hepatectomy plus Tac. The animals were killed one day after hepatectomy, and the remnant livers were weighed and harvested for tissue microarray sections. Liver cell proliferation was evaluated by staining for PCNA and apoptosis was detected by the TUNEL method. It was verified that CsA promoted a decrease in the liver weight, Tac and CsA decreased the proliferation index of hepatocytes, and glucocorticoid had no significant effects. The apoptosis index was not altered by hepatectomy or immunosuppressants. Our data indicate that, in the growing rat, CsA and Tac have negative effects on hepatocyte proliferation and have no effect on the hepatocyte apoptosis.

Binge eating symptoms, diet composition and metabolic characteristics of obese children and adolescents

This study aimed to determine the occurrence of symptoms of binge eating (BE) among children and adolescents seeking treatment for their obesity, as well as to evaluate their diet composition and metabolic characteristics. The Binge Eating scale (BES) was answered by 128 children and adolescents (10.77 +/- 2.04 years, BMI 29.15 +/- 4.98 kg/m(2), BMI Z score 2.28 +/- 0.46, 53.91% pubescent), who were classified into two subgroups-binge eaters (score greater than or equal to IS points) and non-binge eaters (score lower than 18 points). Anthropometric data, body composition and Tanner stages were collected and dietary evaluation conducted. Blood pressure was determined, and glucose, lipid profile and insulin assays were performed. insulin resistance was determined using HOMA-IR. BE symptoms were present in 39.06% of patients. Carbohydrate intake in diet composition was significantly higher among binge eaters. Children with BE did not demonstrate significant dissimilar metabolic characteristics when compared to their counterparts without BE. Therefore, BE seems to be a prevalent problem among children and adolescents seeking help for their obesity. When associated with obesity, this eating behaviour can influence macronutrient consumption through increased carbohydrate intake. Further research would be valuable to verify the reproducibility of these findings. (c) 2007 Elsevier Ltd. All rights reserved.

Small airway remodeling in acute respiratory distress syndrome: a study in autopsy lung tissue

Introduction: Airway dysfunction in patients with the Acute Respiratory Distress Syndrome (ARDS) is evidenced by expiratory flow limitation and dynamic hyperinflation. These functional alterations have been attributed to closure/obstruction of small airways. Airway morphological changes have been reported in experimental models of acute lung injury, characterized by epithelial necrosis and denudation in distal airways. To date, however, no study has focused on the morphological airway changes in lungs from human subjects with ARDS. The aim of this study is to evaluate structural and inflammatory changes in distal airways in ARDS patients. Methods: We retrospectively studied autopsy lung tissue from subjects who died with ARDS and from control subjects who died of non pulmonary causes. Using image analysis, we quantified the extension of epithelial changes (normal, abnormal and denudated epithelium expressed as percentages of the total epithelium length), bronchiolar inflammation, airway wall thickness, and extracellular matrix (ECM) protein content in distal airways. The Student`s t test or the Mann-Whitney test was used to compare data between the ARDS and control groups. Bonferroni adjustments were used for multiple tests. The association between morphological and clinical data was analyzed by Pearson rank test. Results: Thirty-one ARDS patients (A: PaO(2)/FiO(2) <= 200, 45 +/- 14 years, 16 males) and 11 controls (C:52 +/- 16 years, 7 males) were included in the study. ARDS airways showed a shorter extension of normal epithelium (A:32.9 +/- 27.2%, C:76.7 +/- 32.7%, P < 0.001), a larger extension of epithelium denudation (A:52.6 +/- 35.2%, C:21.8 +/- 32.1%, P < 0.01), increased airway inflammation (A:1(3), C:0(1), P = 0.03), higher airway wall thickness (A:138.7 +/- 54.3 mu m, C:86.4 +/- 33.3 mu m, P < 0.01), and higher airway content of collagen I, fibronectin, versican and matrix metalloproteinase-9 (MMP-9) compared to controls (P = 0.03). The extension of normal epithelium showed a positive correlation with PaO(2)/FiO(2) (r(2) = 0.34; P = 0.02) and a negative correlation with plateau pressure (r(2) = 0.27; P = 0.04). The extension of denuded epithelium showed a negative correlation with PaO(2)/FiO(2) (r(2) = 0.27; P = 0.04). Conclusions: Structural changes in small airways of patients with ARDS were characterized by epithelial denudation, inflammation and airway wall thickening with ECM remodeling. These changes are likely to contribute to functional airway changes in patients with ARDS.

Severe and refractory myositis in mixed connective tissue disease: a description of a rare case

Mixed connective tissue disease (MCTD) is a rare disease that includes clinical and laboratorial manifestations of systemic lupus erythematosus, scleroderma and polymyositis that is associated with high titers of anti-U1RNP antibodies. In general, muscle involvement is subclinical, usually appearing as an increase in muscle enzyme levels that tends to be a characteristic of the initial phases of the disease. Severe clinical muscle weakness is not observed in this disease. The objective of this study is to report a rare case of a patient who presented a severe onset of myositis characterized by dysphagia, an increase in myopathy and a weakening of the cervical musculature. While there was no response to the administration of an initial dose of corticosteroids, improvement was observed after increasing the dose of corticosteroids, in addition to the initiation of pulse therapy with methylprednisolone accompanied by methotrexate treatment. The authors emphasize that there is only one previously reported case regarding a child with MCTD and severe clinical myopathy on electromyography and muscle biopsy, and they report in this article one adult female patient who presented severe myositis and was refractive to corticotherapy. Lupus (2010) 19, 1659-1661.

Effects of Time on Ultrastructural Integrity of Parathyroid Tissue Before Cryopreservation

Cryopreservation of parathyroid tissue is used in the surgical treatment of secondary hyperparathyroidism. After surgical resection, the tissue is temporarily maintained in a cell culture solution until it arrives at the specialized laboratory where the cryopreservation process will take place. The present study evaluates the time that the human hyperplastic parathyroid gland tissue can wait before cryopreservation, based on parathyroid cell ultrastructural integrity. This prospective study included 11 patients who underwent total parathyroidectomy with heterotopic autotransplantation and cryopreservation of parathyroid tissue fragments. Part of the tissue was kept in cell culture solution at 4A degrees C. Five time periods between 2 and 24 h were defined, and parathyroid fragments were kept in the solution for that length of time. At the end of each period, the fragments were removed from the transport solution, fixed, and prepared for ultrathin sections. Of the 11 cases studied, 10 showed ultrastructural findings consistent with cellular viability in tissue fragments that remained in the transport solution up to 12 h. Electron microscopy revealed that cell adhesion and the integrity of plasma membranes, nuclei, and mitochondria were preserved in one case for up to 24 h. Changes in mitochondrial structure represented the most constant ultrastructural damage seen in the cases studied, in addition to the presence of edema and cell vacuoles. Analysis of the ultrastructure of hyperplastic parathyroid gland tissue showed that ultrastructural integrity was in most cases properly maintained in fragments stored up to 12 h in a cell culture solution at 4A degrees C.

cDNA microarray analysis of differentially expressed genes in penile tissue after treatment with tadalafil

To evaluate differential gene expression in penile tissue after treatment with the phosphodiesterase 5 (PDE5) inhibitor tadalafil, as of the three clinically available PDE5 inhibitors (sildenafil, tadalafil, and vardenafil) used for the treatment of erectile dysfunction (ED), tadalafil has a long half-life and low incidence of side-effects. In all, 32 adult rats were divided into two groups. The control group received 0.5 mL of drinking water alone, while the tadalafil group was treated with tadalafil at a dose of 0.27 mg/kg. At 4 h after treatment with water or tadalafil the rats were killed and the penile tissue was removed. The total RNA was isolated from the penile tissue from both groups and differentially expressed genes were identified by cDNA microarray analysis. To validate the expression data from the microarray analysis, quantitative real-time polymerase chain reaction (PCR) and immunohistochemistry were used. In all, 153 genes were differentially expressed between the control group and the tadalafil group. We validated the microarray results by quantitative PCR for the insulin-like growth factor binding protein 6 (IGFBP-6) gene and the neuronal calcium sensor 1 (NCS-1) gene, both of which were up-regulated in the tadalafil group, and for the natriuretic peptide receptor 1 (NPR-1) gene that was down-regulated in this group. Immunohistochemistry showed localization of the NCS-1 protein in sinusoid trabeculae of the corpus cavernosum in control and tadalafil-treated rats. There was differential expression in 153 genes after tadalafil treatment. Some of these genes such as IGFBP-6, NPR-1 and NCS-1, might result in new targets in the treatment of ED.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Potassium in Hemorrhagic Shock: A Potential Marker of Tissue Hypoxia

Background: This study was designed to evaluate serum potassium level variation in a porcine model of hemorrhagic shock ( HS). Methods: Eight pigs were studied in a controlled hemorrhage model of HS. Blood withdrawal began at a 50 mL/min to 70 mL/min rate, adjusted to reach a mean arterial pressure ( MAP) level of 60 mm Hg in 10 minutes. When MAP reached 60 mm Hg, the blood withdrawal rate was adjusted to maintain a MAP decrease rate of 10 mm Hg every 2 minutes to 4 minutes. Arterial and mixed venous blood samples were collected at MAP levels of 60 mm Hg, 50 mm Hg, 40 mm Hg, 30 mm Hg, 20 mm Hg, and 10 mm Hg and analyzed for oxygen saturation, PO(2), PCO(2), potassium, lactate, bicarbonate, hemoglobin, pH, and standard base excess. Results: Significant increase in serum potassium occurred early in all animals. The rate of rise in serum potassium and its levels accompanied the hemodynamic deterioration. Hyperkalemia ( K >5 mmol/L) incidence was 12.5% at 60 mm Hg and 50 mm Hg, 62.5% at 40 mm Hg, 87.5% at 30 mm Hg, and 100% at 20 mm Hg. Strong correlations were found between potassium levels and lactate ( R = 0.82), SvO(2) ( R = 0.87), Delta pH ( R = 0.83), and Delta PCO(2) ( R = 0.82). Conclusions: Serum potassium increase accompanies the onset of HS. The rise in serum potassium was directly related to the hemodynamic deterioration of HS and strongly correlated with markers of tissue hypoxia.

Collagen and Elastic Content of Abdominal Skin After Surgical Weight Loss

Collapsed skin folds after bariatric weight loss are often managed by plastic procedures, but changes in dermal composition and architecture have rarely been documented. Given the potential consequences on surgical outcome, a prospective histochemical study was designed. The hypothesis was that a deranged dermal fiber pattern would accompany major changes in adipose tissue. Female surgical candidates undergoing postbariatric abdominoplasty (n = 40) and never obese women submitted to control procedures (n = 40) were submitted to double abdominal biopsy, respectively in the epigastrium and hypogastrium. Histomorphometric assessment of collagen and elastic fibers was executed by the Image Analyzer System (Kontron Electronic 300, Zeiss, Germany). Depletion of collagen, but not of elastic fibers, in cases with massive weight loss was confirmed. Changes were somewhat more severe in epigastrium (P = 0.001) than hypogastrium (P = 0.007). Correlation with age did not occur. (1) Patients displayed lax, soft skin lacking sufficient collagen fiber network. (2) Elastic fiber content was not damaged, and was even moderately increased in epigastrium; (3) Preoperative obesity negatively correlated with hypogastric collagen concentration; (4) Future studies should pinpoint the roles of obesity, and especially of massive weight loss, on dermal architecture and response to surgery.

Penetration of cefuroxime in subcutaneous tissue during coronary artery bypass grafting surgery

A sensitive and rapid HPLC assay for determining cefuroxime penetration in the subcutaneous tissue near to surgical incision of patients submitted to coronary artery bypass grafting (CABC) with or without cardiopulmonary bypass (CPB) was performed. Blood and subcutaneous tissue samples were collected from 14 patients. in four periods during surgery. The analytical method presented linearity from 0.5 to 100 mu g/g. LOQ = 0.50 mu g/g, LOD = 0.25 mu g/g. intra- and interday precision (%CV) ranged from 4.9 to 8.9% and 6.4 to 9.9%, respectively, and intra-and interday accuracy expressed as % of the nominal concentration ranged from 87.1 to 104.6% and 94.8 to 103.8%, respectively (mean of three concentrations). Relative recovery was 98.4%. Tissue/plasma ratios obtained for CPB and non-CPB were, respectively: 14.6% vs 19.0% (0.6 h); 15.7% vs 15.7% (2.1 h); 22.5% vs 19.9% (3.6 h); 15.7% vs 18.8% (4.5 h). Data obtained indicate that tissue/plasma ratio remains unchanged in CPB and non-CPB patients during all period of surgery and the CPB does not affect the penetration of cefuroxime in tissues close to the surgical wound. (C) 2009 Elsevier B.V. All rights reserved.

Ratio of Metalloproteinase 2 to Tissue Inhibitor of Metalloproteinase 2 in Medullary Thyroid Carcinoma

Objectives: To develop an index for the ratio of metalloproteinase 2 (MMP-2) to its tissue inhibitor (TIMP-2) in immunostained medullary thyroid carcinoma specimens and to correlate it with clinical and pathologic prognostic factors. Metalloproteinases, enzymes related to the degradation of the extracellular matrix, take part in carcinogenesis and have been associated with the prognosis of neoplasias. Nevertheless, medullary carcinoma is rarely considered in research analysis. Researchers tend to favor the ratio of enzymes to their inhibitors over the absolute concentrations of these enzymes. Design: Retrospective study of surgical samples. Setting: Head and Neck Surgery and Endocrinology Departments, Universidade de Sao Paulo Medical School Hospital. Patients: Surgical specimens from 33 patients who had been observed for a mean of 76.8 months (range, 4-201 months) were immunohistochemically stained for MMP-2 and TIMP-2. Only patients whose clinical and pathologic data were complete and whose specimens were preserved were included in the study. Main Outcome Measures: The ratio between the expressions of MMP-2 and TIMP-2 was based on a staining index (immunostaining extent and intensity) of each of the markers. Results: Proportionally large expressions of TIMP-2 over MMP-2 correlated with low occurrences of positive findings on initial cervical examination for the presence of thyroid nodules and/or lymphadenopathy (P = .02) and cervical lymph node metastases (P < .001), conditions correlated with prognosis. A correlation with cure at the end of follow-up (P = .01) was also observed. (P < .05 was considered statistically significant.) Conclusion: The ratio of MMP-2 to TIMP-2 expression is an additional and novel prognostic predictor of the outcome of medullary carcinoma treated surgically.

The Role of Prostate Specific Membrane Antigen and Pepsinogen C Tissue Expression as an Adjunctive Method to Prostate Cancer Diagnosis

Purpose: The diagnosis of prostate cancer in men with persistently increased prostate specific antigen after a negative prostate biopsy has become a great challenge for urologists and pathologists. We analyzed the diagnostic value of 6 genes in the tissue of patients with prostate cancer. Materials and Methods: The study was comprised of 50 patients with localized disease who underwent radical prostatectomy. Gene selection was based on a previous microarray analysis. Among 4,147 genes with different expressions between 2 pools of patients 6 genes (PSMA, TMEFF2, GREB1, TH1L, IgH3 and PGC) were selected. These genes were tested for diagnostic value using the quantitative reverse transcription polymerase chain reaction method. Initially malignant tissue samples from 33 patients were analyzed and in the second part of the study we analyzed benign tissue samples from the other 17 patients with prostate cancer. The control group was comprised of tissue samples of patients with benign prostatic hyperplasia. Results: Analysis of malignant prostatic tissue demonstrated that prostate specific membrane antigen was over expressed (mean 9 times) and pepsinogen C was under expressed (mean 1.3 X 10(-4) times) in all cases compared to benign prostatic hyperplasia. The other 4 tested genes showed a variable expression pattern not allowing for differentiation between benign and malignant cases. When we tested these results in the benign prostate tissues from patients with cancer, pepsinogen C maintained the expression pattern. In terms of prostate specific membrane antigen, despite over expression in most cases (mean 12 times), 2 cases (12%) presented with under expression. Conclusions: Pepsinogen C tissue expression may constitute a powerful adjunctive method to prostate biopsy in the diagnosis of prostate cancer cases.

Effects of magnesium intake deficiency on bone metabolism and bone tissue around osseointegrated implants

Objectives: This study evaluated the effect of magnesium dietary deficiency on bone metabolism and bone tissue around implants with established osseointegration. Materials and methods: For this, 30 rats received an implant in the right tibial metaphysis. After 60 days for healing of the implants, the animals were divided into groups according to the diet received Control group (CTL) received a standard diet with adequate magnesium content, while test group (Mg) received the same diet except for a 90% reduction of magnesium. The animals were sacrificed after 90 days for evaluation of calcium, magnesium, osteocalcin and parathyroid hormone (PTH) serum levels and the deoxypyridinoline (DPD) level in the urine. The effect of magnesium deficiency on skeletal bone tissue was evaluated by densitometry of the lumbar vertebrae, while the effect of bone tissue around titanium implants was evaluated by radiographic measurement of cortical bone thickness and bone density. The effect on biomechanical characteristics was verified by implant removal torque testing. Results: Magnesium dietary deficiency resulted in a decrease of the magnesium serum level and an increase of PTH and DPD levels (P <= 0.05). The Mg group also presented a loss of systemic bone mass decreased cortical bone thickness and lower values of removal torque of the implants (P <= 0.01). Conclusions: The present study concluded that magnesium-deficient diet had a negative influence on bone metabolism as well as on the bone tissue around the implants.

Evidence that two independent host genes influence the severity of tissue damage and susceptibility to acute pyelonephritis in murine systemic candidiasis

Tissue damage in the kidney and brain after systemic infection with Candida albicans was examined in recombinant inbred strains (AKXL) derived from AKR and C57/L progenitors. Nine of the 15 strains showed mild (C57/L-like) tissue damage. Of the remainder, two strains developed lesions comparable to the AKR parental strain, whereas four exhibited a much move severe pattern of tissue damage. This was characterized by pronounced mycelial growth in the brain, and gross oedema of the kidney, with extensive fungal colonization and marked tissue destruction. The presence of the null allele of the haemolytic complement gene (Hc) may be necessary but not sufficient, for the expression of the very severe lesions. The results were interpreted as reflecting the actions of two independent genes, which have been designated Carg1 and Carg2 (Candida albicans resistance genes 1 and 2). (C) 1997 Academic Press Limited.