991 resultados para SEQUENCE VARIABILITY


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The incidence of human infections by the fungal pathogen Candida species has been increasing in recent years. Enolase is an essential protein in fungal metabolism. Sequence data is available for human and a number of medically important fungal species. An understanding of the structural and functional features of fungal enolases may provide the structural basis for their use as a target for the development of new anti-fungal drugs. We have obtained the sequence of the enolase of Candida krusei (C. krusei), as it is a significant medically important fungal pathogen. We have then used multiple sequence alignments with various enolase isoforms in order to identify C. krusei specific amino acid residues. The phylogenetic tree of enolases shows that the C. krusei enolase assembles on the tree with the fungal genes. Importantly, C. krusei lacks four amino acids in the active site compared to human enolase, as revealed by multiple sequence alignments. These differences in the substrate binding site may be exploited for the design of new anti-fungal drugs to selectively block this enzyme. The lack of the important amino acids in the active site also indicates that C. krusei enolase might have evolved as a member of a mechanistically diverse enolase superfamily catalying somewhat different reactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Site-specific geotechnical data are always random and variable in space. In the present study, a procedure for quantifying the variability in geotechnical characterization and design parameters is discussed using the site-specific cone tip resistance data (qc) obtained from static cone penetration test (SCPT). The parameters for the spatial variability modeling of geotechnical parameters i.e. (i) existing trend function in the in situ qc data; (ii) second moment statistics i.e. analysis of mean, variance, and auto-correlation structure of the soil strength and stiffness parameters; and (iii) inputs from the spatial correlation analysis, are utilized in the numerical modeling procedures using the finite difference numerical code FLAC 5.0. The influence of consideration of spatially variable soil parameters on the reliability-based geotechnical deign is studied for the two cases i.e. (a) bearing capacity analysis of a shallow foundation resting on a clayey soil, and (b) analysis of stability and deformation pattern of a cohesive-frictional soil slope. The study highlights the procedure for conducting a site-specific study using field test data such as SCPT in geotechnical analysis and demonstrates that a few additional computations involving soil variability provide a better insight into the role of variability in designs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The genome sequence of Caloramator mitchellensis strain VF08, a rod-shaped, heterotrophic, strictly anaerobic bacterium iso-lated from the free-flowing waters of a Great Artesian Basin (GAB) bore well located in Mitchell, an outback Queensland town in Australia, is reported here. The analysis of the 2.42-Mb genome sequence indicates that the attributes of the genome are consistent with its physiological and phenotypic traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Evolutionary genetics incorporates traditional population genetics and studies of the origins of genetic variation by mutation and recombination, and the molecular evolution of genomes. Among the primary forces that have potential to affect the genetic variation within and among populations, including those that may lead to adaptation and speciation, are genetic drift, gene flow, mutations and natural selection. The main challenges in knowing the genetic basis of evolutionary changes is to distinguish the adaptive selection forces that cause existent DNA sequence variants and also to identify the nucleotide differences responsible for the observed phenotypic variation. To understand the effects of various forces, interpretation of gene sequence variation has been the principal basis of many evolutionary genetic studies. The main aim of this thesis was to assess different forms of teleost gene sequence polymorphisms in evolutionary genetic studies of Atlantic salmon (Salmo salar) and other species. Firstly, the level of Darwinian adaptive evolution affected coding regions of the growth hormone (GH) gene during the teleost evolution was investigated based on the sequence data existing in public databases. Secondly, a target gene approach was used to identify within population variation in the growth hormone 1 (GH1) gene in salmon. Then, a new strategy for single nucleotide polymorphisms (SNPs) discovery in salmonid fishes was introduced, and, finally, the usefulness of a limited number of SNP markers as molecular tools in several applications of population genetics in Atlantic salmon was assessed. This thesis showed that the gene sequences in databases can be utilized to perform comparative studies of molecular evolution, and some putative evidence of the existence of Darwinian selection during the teleost GH evolution was presented. In addition, existent sequence data was exploited to investigate GH1 gene variation within Atlantic salmon populations throughout its range. Purifying selection is suggested to be the predominant evolutionary force controlling the genetic variation of this gene in salmon, and some support for gene flow between continents was also observed. The novel approach to SNP discovery in species with duplicated genome fragments introduced here proved to be an effective method, and this may have several applications in evolutionary genetics with different species - e.g. when developing gene-targeted markers to investigate quantitative genetic variation. The thesis also demonstrated that only a few SNPs performed highly similar signals in some of the population genetic analyses when compared with the microsatellite markers. This may have useful applications when estimating genetic diversity in genes having a potential role in ecological and conservation issues, or when using hard biological samples in genetic studies as SNPs can be applied with relatively highly degraded DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Visual pigments of different animal species must have evolved at some stage to match the prevailing light environments, since all visual functions depend on their ability to absorb available photons and transduce the event into a reliable neural signal. There is a large literature on correlation between the light environment and spectral sensitivity between different fish species. However, little work has been done on evolutionary adaptation between separated populations within species. More generally, little is known about the rate of evolutionary adaptation to changing spectral environments. The objective of this thesis is to illuminate the constraints under which the evolutionary tuning of visual pigments works as evident in: scope, tempo, available molecular routes, and signal/noise trade-offs. Aquatic environments offer Nature s own laboratories for research on visual pigment properties, as naturally occurring light environments offer an enormous range of variation in both spectral composition and intensity. The present thesis focuses on the visual pigments that serve dim-light vision in two groups of model species, teleost fishes and mysid crustaceans. The geographical emphasis is in the brackish Baltic Sea area with its well-known postglacial isolation history and its aquatic fauna of both marine and fresh-water origin. The absorbance spectrum of the (single) dim-light visual pigment were recorded by microspectrophotometry (MSP) in single rods of 26 fish species and single rhabdoms of 8 opossum shrimp populations of the genus Mysis inhabiting marine, brackish or freshwater environments. Additionally, spectral sensitivity was determined from six Mysis populations by electroretinogram (ERG) recording. The rod opsin gene was sequenced in individuals of four allopatric populations of the sand goby (Pomatoschistus minutus). Rod opsins of two other goby species were investigated as outgroups for comparison. Rod absorbance spectra of the Baltic subspecies or populations of the primarily marine species herring (Clupea harengus membras), sand goby (P. minutus), and flounder (Platichthys flesus) were long-wavelength-shifted compared to their marine populations. The spectral shifts are consistent with adaptation for improved quantum catch (QC) as well as improved signal-to-noise ratio (SNR) of vision in the Baltic light environment. Since the chromophore of the pigment was pure A1 in all cases, this has apparently been achieved by evolutionary tuning of the opsin visual pigment. By contrast, no opsin-based differences were evident between lake and sea populations of species of fresh-water origin, which can tune their pigment by varying chromophore ratios. A more detailed analysis of differences in absorbance spectra and opsin sequence between and within populations was conducted using the sand goby as model species. Four allopatric populations from the Baltic Sea (B), Swedish west coast (S), English Channel (E), and Adriatic Sea (A) were examined. Rod absorbance spectra, characterized by the wavelength of maximum absorbance (λmax), differed between populations and correlated with differences in the spectral light transmission of the respective water bodies. The greatest λmax shift as well as the greatest opsin sequence difference was between the Baltic and the Adriatic populations. The significant within-population variation of the Baltic λmax values (506-511 nm) was analyzed on the level of individuals and was shown to correlate well with opsin sequence substitutions. The sequences of individuals with λmax at shorter wavelengths were identical to that of the Swedish population, whereas those with λmax at longer wavelengths additionally had substitution F261F/Y in the sixth transmembrane helix of the protein. This substitution (Y261) was also present in the Baltic common gobies and is known to redshift spectra. The tuning mechanism of the long-wavelength type Baltic sand gobies is assumed to be the co-expression of F261 and Y261 in all rods to produce ≈ 5 nm redshift. The polymorphism of the Baltic sand goby population possibly indicates ambiguous selection pressures in the Baltic Sea. The visual pigments of all lake populations of the opossum shrimp (Mysis relicta) were red-shifted by 25 nm compared with all Baltic Sea populations. This is calculated to confer a significant advantage in both QC and SNR in many humus-rich lakes with reddish water. Since only A2 chromophore was present, the differences obviously reflect evolutionary tuning of the visual protein, the opsin. The changes have occurred within the ca. 9000 years that the lakes have been isolated from the Sea after the most recent glaciation. At present, it seems that the mechanism explaining the spectral differences between lake and sea populations is not an amino acid substitution at any other conventional tuning site, but the mechanism is yet to be found.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Sequence specific interaction between DNA and protein molecules has been a subject of active investigation for decades now. Here, we have chosen single promoter containing bacteriophage Delta D-III T7 DNA and Escherichia coli RNA polymerase and followed their recognition at the air-water interface by using the surface plasmon resonance (SPR) technique, where the movement of one of the reacting species is restricted by way of arraying them on an immobilized support. For the Langmuir monolayer studies, we used a RNA polymerase with a histidine tag attached to one of its subunits, thus making it an xcellent substrate for Ni(II) ions, while the SPR Studies were done using biotin-labeled DNA immobilized on a streptavidin-coated chip. Detailed analysis of the thermodynamic parameters as a function of concentration and temperature revealed that the interaction of RNA polymerase with T7 DNA is largely entropy driven (83 (+/- 12) kcal mol(-1)) with a positive enthalpy of 13.6 (+/- 3.6) kcal mol(-1), The free energy of reaction determined by SPR and Langmuir-Blodgett technique was -11 (+/- 2) and -15.6 kcal mol(-1), respectively. The ability of these methods to retain the specificity of the recognition process was also established.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An isolated wind power generation scheme using slip ring induction machine (SRIM) is proposed. The proposed scheme maintains constant load voltage and frequency irrespective of the wind speed or load variation. The power circuit consists of two back-to-back connected inverters with a common dc link, where one inverter is directly connected to the rotor side of SRIM and the other inverter is connected to the stator side of the SRIM through LC filter. Developing a negative sequence compensation method to ensure that, even under the presence of unbalanced load, the generator experiences almost balanced three-phase current and most of the unbalanced current is directed through the stator side converter is the focus here. The SRIM controller varies the speed of the generator with variation in the wind speed to extract maximum power. The difference of the generated power and the load power is either stored in or extracted from a battery bank, which is interfaced to the common dc link through a multiphase bidirectional fly-back dc-dc converter. The SRIM control scheme, maximum power point extraction algorithm and the fly-back converter topology are incorporated from available literature. The proposed scheme is both simulated and experimentally verified.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In recent years, identification of sequence patterns has been given immense importance to understand better their significance with respect to genomic organization and evolutionary processes. To this end, an algorithm has been derived to identify all similar sequence repeats present in a protein sequence. The proposed algorithm is useful to correlate the three-dimensional structure of various similar sequence repeats available in the Protein Data Bank against the same sequence repeats present in other databases like SWISS-PROT, PIR and Genome databases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

CONTEXT: Polyalanine tract variations in transcription factors have been identified for a wide spectrum of developmental disorders. The thyroid transcription factor forkhead factor E1 (FOXE1) contains a polymorphic polyalanine tract with 12-22 alanines. Single-nucleotide polymorphisms (SNP) close to this locus are associated with papillary thyroid cancer (PTC), and a strong linkage disequilibrium block extends across this region. OBJECTIVE: The objective of the study was to assess whether the FOXE1 polyalanine repeat region was associated with PTC and to assess the effect of polyalanine repeat region variants on protein expression, DNA binding, and transcriptional function on FOXE1-responsive promoters. DESIGN: This was a case-control study. SETTING: The study was conducted at a tertiary referral hospital. PATIENTS AND METHODS: The FOXE1 polyalanine repeat region and tag SNP were genotyped in 70 PTC, with a replication in a further 92 PTC, and compared with genotypes in 5767 healthy controls (including 5667 samples from the Wellcome Trust Case Control Consortium). In vitro studies were performed to examine the protein expression, DNA binding, and transcriptional function for FOXE1 variants of different polyalanine tract lengths. RESULTS: All the genotyped SNP were in tight linkage disequilibrium, including the FOXE1 polyalanine repeat region. We confirmed the strong association of rs1867277 with PTC (overall P = 1 × 10(-7), odds ratio 1.84, confidence interval 1.31-2.57). rs1867277 was in tight linkage disequilibrium with the FOXE1 polyalanine repeat region (r(2) = 0.95). FOXE1(16Ala) was associated with PTC with an odds ratio of 2.23 (confidence interval 1.42-3.50; P = 0.0005). Functional studies in vitro showed that FOXE1(16Ala) was transcriptionally impaired compared with FOXE1(14Ala), which was not due to differences in protein expression or DNA binding. CONCLUSIONS: We have confirmed the previous association of FOXE1 with PTC. Our data suggest that the coding polyalanine expansion in FOXE1 may be responsible for the observed association between FOXE1 and PTC.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The i + 5-->i hydrogen bonded turn conformation (pi-turn) with the fifth residue adopting alpha L conformation is frequently found at the C-terminus of helices in proteins and hence is speculated to be a "helix termination signal." An analysis of the occurrence of i + 5-->i hydrogen bonded turn conformation at any general position in proteins (not specifically at the helix C-terminus), using coordinates of 228 protein crystal structures determined by X-ray crystallography to better than 2.5 A resolution is reported in this paper. Of 486 detected pi-turn conformations, 367 have the (i + 4)th residue in alpha L conformation, generally occurring at the C-terminus of alpha-helices, consistent with previous observations. However, a significant number (111) of pi-turn conformations occur with (i + 4)th residue in alpha R conformation also, generally occurring in alpha-helices as distortions either at the terminii or at the middle, a novel finding. These two sets of pi-turn conformations are referred to by the names pi alpha L and pi alpha R-turns, respectively, depending upon whether the (i + 4)th residue adopts alpha L or alpha R conformations. Four pi-turns, named pi alpha L'-turns, were noticed to be mirror images of pi alpha L-turns, and four more pi-turns, which have the (i + 4)th residue in beta conformation and denoted as pi beta-turns, occur as a part of hairpin bend connecting twisted beta-strands. Consecutive pi-turns occur, but only with pi alpha R-turns. The preference for amino acid residues is different in pi alpha L and pi alpha R-turns. However, both show a preference for Pro after the C-termini. Hydrophilic residues are preferred at positions i + 1, i + 2, and i + 3 of pi alpha L-turns, whereas positions i and i + 5 prefer hydrophobic residues. Residue i + 4 in pi alpha L-turns is mainly Gly and less often Asn. Although pi alpha R-turns generally occur as distortions in helices, their amino acid preference is different from that of helices. Poor helix formers, such as His, Tyr, and Asn, also were found to be preferred for pi alpha R-turns, whereas good helix former Ala is not preferred. pi-Turns in peptides provide a picture of the pi-turn at atomic resolution. Only nine peptide-based pi-turns are reported so far, and all of them belong to pi alpha L-turn type with an achiral residue in position i + 4. The results are of importance for structure prediction, modeling, and de novo design of proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.