Human von Willebrand factor gene sequences target expression to a subpopulation of endothelial cells in transgenic mice.

The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.

Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF) 1 genes reveal evolutionary conservation in the IRF gene family.

Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.

Conditional transformation of a pancreatic beta-cell line derived from transgenic mice expressing a tetracycline-regulated oncogene.

Conditional oncogene expression in transgenic mice is of interest for studying the oncoprotein requirements during tumorigenesis and for deriving cell lines that can be induced to undergo growth arrest and enhance their differentiated functions. We utilized the bacterial tetracycline (Tet)-resistance operon regulatory system (tet) from Tn10 of Escherichia coli to control simian virus 40 (SV40) large tumor (T) antigen (TAg) gene expression and to generate conditionally transformed pancreatic beta cells in transgenic mice. A fusion protein containing the tet repressor (tetR) and the activating domain of the herpes simplex virus protein VP16, which converts the repressor into a transcription activator, was produced in beta cells of transgenic mice under control of the insulin promoter. In a separate lineage of transgenic mice, the TAg gene was introduced under control of a tandem array of tet operator sequences and a minimal promoter, which by itself is not sufficient for gene expression. Mice from the two lineages were then crossed to generate double-transgenic mice. Expression of the tetR fusion protein in beta cells activated TAg transcription, resulting in the development of beta-cell tumors. Tumors arising in the absence of Tet were cultured to derive a stable beta-cell line. Cell incubation in the presence of Tet led to inhibition of proliferation, as shown by decreased BrdUrd and [3H]thymidine incorporation. The Tet derivative anhydrotetracycline showed a 100-fold stronger inhibition compared with Tet. When administered in vivo, Tet efficiently inhibited beta-cell proliferation. These findings indicate that transformed beta cells selected for growth during a tumorigenesis process in vivo maintain a dependence on the continuous presence of the TAg oncoprotein for their proliferation. This system provides an approach for generation of beta-cell lines for cell therapy of diabetes as well as conditionally transformed cell lines from other cell types of interest.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Tauroursodeoxycholic acid prevents retinal degeneration in transgenic P23H rats

Purpose. To evaluate the preventive effect of tauroursodeoxycholic acid (TUDCA) on photoreceptor degeneration, synaptic connectivity and functional activity of the retina in the transgenic P23H rat, an animal model of autosomal dominant retinitis pigmentosa (RP). Methods. P23H line-3 rats were injected with TUDCA once a week from postnatal day (P)21 to P120, in parallel with vehicle-administered controls. At P120, functional activity of the retina was evaluated by electroretinographic (ERG) recording. The effects of TUDCA on the number, morphology, integrity, and synaptic connectivity of retinal cells were characterized by immunofluorescence confocal microscopy. Results. The amplitude of ERG a- and b-waves was significantly higher in TUDCA-treated animals under both scotopic and photopic conditions than in control animals. In the central area of the retina, TUDCA-treated P23H rats showed threefold more photoreceptors than control animals. The number of TUNEL-positive cells was significantly smaller in TUDCA-treated rats, in which photoreceptor morphology was preserved. Presynaptic and postsynaptic elements, as well as the synaptic contacts between photoreceptors and bipolar or horizontal cells, were preserved in TUDCA-treated P23H rats. Furthermore, in TUDCA-treated rat retinas, the number of both rod bipolar and horizontal cell bodies, as well as the density of their synaptic terminals in the outer plexiform layer, was greater than in control rats. Conclusions. TUDCA treatment was capable of preserving cone and rod structure and function, together with their contacts with their postsynaptic neurons. The neuroprotective effects of TUDCA make this compound potentially useful for delaying retinal degeneration in RP.

Is Regulatory Convergence Efficient? CES Germany & Europe Working Papers, No. 02.3, May 1992

One of the important themes in the new institutionalism is the convergence of market regulations in a world with three powerful clusters of countries (Western Europe, North America, and East Asia) on a small number of regimes, like disorganized capitalism, free market capitalism, and coordinated market capitalism. This paper examines the political-economic theory of regulatory convergence. It reconstructs and compares three welfarist approaches: the optimal regulatory regime (Tinbergen), the rule of constitutional law (Buchanan), and regulatory rivalry (Hayek). The paper concludes that most plausible results of convergence theory are completely opposite to the expressed political intentions of the theorists. Tinbergen's theory predicts neoliberalism, not social democracy. The theories of Buchanan and Hayek predict respectively a consensual or spontaneous formation of corporatist regulations, not the return of classical constitutionalism or liberalism. The paper summons new institutionalists to repair the weak scientific elements of convergence theory and to make a distinction between the ideological origins of this theory and its unintended ideological consequences.

Function and Regulation of Cytochrome P450 4V2 and the Implications in Bietti���s Crystalline Dystrophy

Thesis (Ph.D.)--University of Washington, 2016-06

A macrophage colony-stimulating factor receptor-green fluorescent protein transgene is expressed throughout the mononuclear phagocyte system of the mouse

The c-fms gene encodes the receptor for macrophage colony-stimulating factor (CSF-1). The gene is expressed selectively in the macrophage and trophoblast cell lineages. Previous studies have indicated that sequences in intron 2 control transcript elongation in tissue-specific and regulated expression of c-fms. In humans, an alternative promoter was implicated in expression of the gene in trophoblasts. We show that in mice, c-fms transcripts in trophoblasts initiate from multiple points within the 2-kilobase (kb) region flanking the first coding exon. A reporter gene construct containing 3.5 kb of 5' flanking sequence and the down-stream intron 2 directed expression of enhanced green fluorescent protein (EGFP) to both trophoblasts and macrophages. EGFP was detected in trophoblasts from the earliest stage of implantation examined at embryonic day 7.5. During embryonic development, EGFP highlighted the large numbers of c-fms-positive macrophages, including those that originate from the yolk sac. In adult mice, EGFP location Was consistent with known F4/80-positive macrophage populations, including Langerhans cells of the skin, and permitted convenient sorting of isolated tissue macrophages from disaggregated tissue. Expression of EGFP in transgenic mice was dependent on intron 2 as no lines with detectable EGFP expression were obtained where either all of intron 2 or a conserved enhancer element FIRE (the Fms intronic regulatory element) was removed. We have therefore defined the elements required to generate myeloid- and trophoblast-specific transgenes as well as a model system for the study of mononuclear phagocyte development and function. (C) 2003 by The American Society of Hematology.

Distinct cis-elements in the Asparagus officinalis asparagine synthetase promoter respond to carbohydrate and senescence signals

The Asparagus officinalis L. asparagine (Asn) synthetase (AS) promoter was analysed for elements responding to carbohydrate and senescence signals. Transgenic Arabidopsis thaliana L. plants containing deletion constructs of the ���1958 bp AS promoter linked to the ��-glucuronidase (GUS) reporter gene (AS::GUS) were analysed by measuring GUS specific activity. Inclusion of sucrose (Suc), glucose (Glc) or fructose (Fru) in plant media repressed levels of GUS activity in ���1958AS::GUS plants, regardless of the light environment, with increases in GUS found 1 d after incubation on Suc-lacking media. Hexokinase is likely to be involved in the signal pathway, as Suc, Glc, Fru, 2-deoxy-d-glucose and mannose were more effective repressors than 3-O-methylglucose, and the hexokinase inhibitor mannoheptulose reduced repression. Plants containing AS::GUS constructs with deletions that reduced the promoter to less than ���405 bp did not show low sugar induction. AS::GUS activity was significantly higher in excised leaves induced to senesce by dark storage for 24 h, compared to fresh leaves, for lines containing at least ���640 bp of the AS promoter but not those with ���523 bp or smaller promoter fragments. Fusion of the ���640 to ���523 bp region to a ���381AS::GUS construct generated a promoter that retained senescence induction but lacked low sugar induction. Alignment of this region to the 33-bp senescence-related sequence of the Arabidopsis and Brassica napus L. SAG12 promoters identified the sequence TTGCACG as being conserved in all the promoters, and which may be an important senescence-responsive element.

Identification of functional sequences in the pregenomic RNA promoter of the Banana streak virus Cavendish strain (BSV-Cav)

The promoter regions of plant pararetroviruses direct transcription of the full-length viral genome into a pregenomic RNA that is an intermediate in the replication of the virus. It serves as template for reverse transcription and as polycistronic mRNA for translation to viral proteins. We have identified functional promoter elements in the intergenic region of the Cavendish isolate of Banana streak virus (BSV-Cav), a member of the genus Badnavirus. Potential binding sites for plant transcription factors were found both upstream and downstream of the transcription start site by homology search in the PLACE database of plant cis-acting elements. The functionality of these putative cis-acting elements was tested by constructing loss-of-function and regain-of-function mutant promoters whose activity was quantified in embryogenic sugarcane suspension cells. Four regions that are important for activity of the BSV-Cav promoter were identified: the region containing an as-l-like element, the region around-141 and down to -77, containing several putative transcription factor binding sites, the region including the CAAT-box, and the leader region. The results could help explain the high BSV-Cav promoter activity that was observed previously in transgenic sugarcane plants and give more insight into the plant cell-mediated replication of the viral genome in banana streak disease. (C) 2004 Elsevier B.V. All rights reserved.

The prion protein gene: Identifying regulatory signals using marsupial sequence

The function of the prion protein gene (PRNP) and its normal product PrPC is elusive. We used comparative genomics as a strategy to understand the normal function of PRNP. As the reliability of comparisons increases with the number of species and increased evolutionary distance, we isolated and sequenced a 66.5 kb BAC containing the PRNP gene from a distantly related mammal, the model Australian marsupial Macropus eugenii (tammar wallaby). Marsupials are separated from eutherians such as human and mouse by roughly 180 million years of independent evolution. We found that tammar PRNP, like human PRNP, has two exons. Prion proteins encoded by the tammar wallaby and a distantly related marsupial, Monodelphis domestica (Brazilian opossum) PRNP contain proximal PrP repeats with a distinct, marsupial-specific composition and a variable number. Comparisons of tammar wallaby PRNP with PRNPs from human, mouse, bovine and ovine allowed us to identify non-coding gene regions conserved across the marsupial-eutherian evolutionary distance, which are candidates for regulatory regions. In the PRNP 3' UTR we found a conserved signal for nuclear-specific polyadenylation and the putative cytoplasmic polyadenylation element (CPE), indicating that post-transcriptional control of PRNP mRNA activity is important. Phylogenetic footprinting revealed conserved potential binding sites for the MZF-1 transcription factor in both upstream promoter and intron/intron 1, and for the MEF2, MyTI, Oct-1 and NFAT transcription factors in the intron(s). The presence of a conserved NFAT-binding site and CPE indicates involvement of PrPC in signal transduction and synaptic plasticity. (c) 2004 Elsevier B.V. All rights reserved.

Characterization of a strong, constitutive mung bean (Vigna radiata L.) promoter with a complex mode of regulation in planta

We report the cloning and characterization in tobacco and Arabidopsis of a Vigna radiata L. (mung bean) promoter that controls the expression of VR-ACS1, an auxin-inducible ACC synthase gene. The VR-ACS1 promoter exhibits a very unusual behavior when studied in plants different from its original host, mung bean. GUS and luciferase in situ assays of transgenic plants containing VR-ACS1 promoter fusions show strong constitutive reporter gene expression throughout tobacco and Arabidopsis development. In vitro quantitative analyses show that transgenic plants harboring VR-ACS1 promoter-reporter constructs have on average 4-6 fold higher protein and activity levels of both reporter genes than plants transformed with comparable CaMV 35S promoter fusions. Similar transcript levels are present in VR-ACS1 and CaMV 35S promoter lines, suggesting that the high levels of gene product observed for the VR-ACS1 promoter are the combined result of transcriptional and translational activation. All tested deletion constructs retaining the core promoter region can drive strong constitutive promoter activity in transgenic plants. This is in contrast to mung bean, where expression of the native VR-ACS1 gene is almost undetectable in plants grown under normal conditions, but is rapidly and highly induced by a variety of stimuli. The constitutive behavior of the VR-ACS1 promoter in heterologous hosts is surprising, suggesting that the control mechanisms active in mung bean are impaired in tobacco and Arabidopsis. The 'aberrant' behavior of the VR-ACS1 promoter is further emphasized by its failure to respond to auxin and cycloheximide in heterologous hosts. VR-ACS1 promoter regulatory mechanisms seem to be different from all previously characterized auxin-inducible promoters.

Computational analysis of base composition pattern and promoter elements in the putative promoter regions in relation to expression profiles of 682 human genes on chromosome 22

The base composition pattern (BCP) in the putative promoter region (PPRs) up to 5 Kb lengths of 682 human genes on Chromosome 22 (Chr22) was examined. Two-dimensional (2D) and three-dimensional (3D) functions were designed to delineate the DNA base composition, with four major patterns identified. It is found that 17.6% genes include TATA box, 28.0% GC box, 18.9% CAAT box and 38.4% CpG islands, and approximately 10% genes have one of four putative initiator (Inr) motifs. The occurrence of the promoter elements is tightly associated with the base composition features in the promoter regions, and the associations of the base composition features with occurrence of the promoter elements in the promoter regions mediate tissue-wide expression of the genes in human. The occurrence of two or more promoter elements in the promoter regions is required for the medium- and wide-range expression profiles of the human genes on Chr22. Thus, the reported data shed light on the characteristics of the PPRs of the human genes on Chr22, which may improve our understanding of regulatory roles of the PPRs with occurrence of the promoter elements in gene expression.

Evolving noisy oscillatory dynamics in genetic regulatory networks

We introduce a genetic programming (GP) approach for evolving genetic networks that demonstrate desired dynamics when simulated as a discrete stochastic process. Our representation of genetic networks is based on a biochemical reaction model including key elements such as transcription, translation and post-translational modifications. The stochastic, reaction-based GP system is similar but not identical with algorithmic chemistries. We evolved genetic networks with noisy oscillatory dynamics. The results show the practicality of evolving particular dynamics in gene regulatory networks when modelled with intrinsic noise.

Multilevel modelling for inference of genetic regulatory networks

Time-course experiments with microarrays are often used to study dynamic biological systems and genetic regulatory networks (GRNs) that model how genes in���uence each other in cell-level development of organisms. The inference for GRNs provides important insights into the fundamental biological processes such as growth and is useful in disease diagnosis and genomic drug design. Due to the experimental design, multilevel data hierarchies are often present in time-course gene expression data. Most existing methods, however, ignore the dependency of the expression measurements over time and the correlation among gene expression pro���les. Such independence assumptions violate regulatory interactions and can result in overlooking certain important subject e���ects and lead to spurious inference for regulatory networks or mechanisms. In this paper, a multilevel mixed-e���ects model is adopted to incorporate data hierarchies in the analysis of time-course data, where temporal and subject e���ects are both assumed to be random. The method starts with the clustering of genes by ���tting the mixture model within the multilevel random-e���ects model framework using the expectation-maximization (EM) algorithm. The network of regulatory interactions is then determined by searching for regulatory control elements (activators and inhibitors) shared by the clusters of co-expressed genes, based on a time-lagged correlation coe���cients measurement. The method is applied to two real time-course datasets from the budding yeast (Saccharomyces cerevisiae) genome. It is shown that the proposed method provides clusters of cell-cycle regulated genes that are supported by existing gene function annotations, and hence enables inference on regulatory interactions for the genetic network.