A DHA14 drug efflux gene from Xanthomonas albilineans confers high-level albicidin antibiotic resistance in Escherichia coli

Aims: Identification of a gene for self-protection from the antibiotic-producing plant pathogen Xanthomonas albilineans, and functional testing by heterologous expression. Methods and Results: Albicidin antibiotics and phytotoxins are potent inhibitors of prokaryote DNA replication. A resistance gene (albF) isolated by shotgun cloning from the X. albilineans albicidin-biosynthesis region encodes a protein with typical features of DHA14 drug efflux pumps. Low-level expression of albF in Escherichia coli increased the MIC of albicidin 3000-fold, without affecting tsx-mediated albicidin uptake into the periplasm or resistance to other tested antibiotics. Bioinformatic analysis indicates more similarity to proteins involved in self-protection in polyketide-antibiotic-producing actinomycetes than to multi-drug resistance pumps in other Gram-negative bacteria. A complex promoter region may co-regulate albF with genes for hydrolases likely to be involved in albicidin activation or self-protection. Conclusions: AlbF is the first apparent single-component antibiotic-specific efflux pump from a Gram-negative antibiotic producer. It shows extraordinary efficiency as measured by resistance level conferred upon heterologous expression. Significance and Impact of the Study: Development of the clinical potential of albicidins as potent bactericidial antibiotics against diverse bacteria has been limited because of low yields in culture. Expression of albF with recently described albicidin-biosynthesis genes may enable large-scale production. Because albicidins are X. albilineans pathogenicity factors, interference with AlbF function is also an opportunity for control of the associated plant disease.

Increased DNA Methylation at the AXIN1 Gene in a Monozygotic Twin from a Pair Discordant for a Caudal Duplication Anomaly

The AXIN1 gene has been implicated in caudal duplication anomalies. Its coding region was sequenced in both members of a monozygotic ( MZ) twin pair discordant for a caudal duplication anomaly, but no mutation was found. Using bisulfite sequencing, we examined methylation at the promoter region of the AXIN1 gene in these twins and in twin and age-matched singleton controls. Methylation of the promoter region in peripheral blood mononucleated cells was variable among individuals, including MZ pairs. In the MZ pair discordant for the caudal duplication, this region of the affected twin was significantly more methylated than that of the unaffected twin (), which was significantly more P < .0001 methylated than those of the controls (). We have confirmed that this CpG island does function as a promoter P = .02 in vitro and that its activity is inversely proportional to the extent of methylation. This finding raises the possibility that hypermethylation of the AXIN1 promoter, by mechanisms as yet undetermined, is associated with the malformation. This case may be paradigmatic for some cases of MZ discordance.

Genetic modulation of the response bias towards facial displays of anger and happiness

Background: Investigating genetic modulation of emotion processing may contribute to the understanding of heritable mechanisms of emotional disorders. The aim of the present study was to test the effects of catechol- O-methyltransferase (COMT) val158met and serotonin-transporter-linked promoter region (5-HTTLPR) polymorphisms on facial emotion processing in healthy individuals. Methods: Two hundred and seventy five (167 female) participants were asked to complete a computerized facial affect recognition task, which involved four experimental conditions, each containing one type of emotional face (fearful, angry, sad or happy) intermixed with neutral faces. Participants were asked to indicate whether the face displayed an emotion or was neutral. The COMT-val158met and 5-HTTLPR polymorphisms were genotyped. Results: Met homozygotes (COMT) showed a stronger bias to perceive neutral faces as expressions of anger, compared with val homozygotes. However, the S-homozygotes (5-HTTLPR) showed a reduced bias to perceive neutral faces as expressions of happiness, compared to L-homozygotes. No interaction between 5-HTTLPR and COMT was found. Conclusions: These results add to the knowledge of individual differences in social cognition that are modulated via serotonergic and dopaminergic systems. This potentially could contribute to the understanding of the mechanisms of susceptibility to emotional disorders. © 2013 Elsevier Masson SAS.

An investigation into the effects of metabolic disturbance on monocyte inflammatory response and regulation

The presence of chronic inflammation is associated with increased nutrient availability during obesity or type 2 diabetes which contributes to the development of complications such as atherosclerosis, stroke and myocardial infarction. The link between increased nutrient availability and inflammatory response remains poorly understood. The functioning of monocytes, the primary instigators of the inflammatory response was assessed in response to obesity and increased glucose availability. Monocyte microRNA expression was assessed in obese individuals prior to and up to one year after bariatric surgery. A number of microRNAs were identified to be dysregulated in obesity, some of which have previously been linked to the regulation of monocyte inflammatory responses including the microRNAs 146a-5p and 424-5p. Weight loss in response to bariatric surgery lead to the reversal of microRNA changes towards control values. In vitro treatments of THP-1 monocytes with high concentrations of D-glucose resulted in decreased intracellular NAD+:NADH ratio, decreased SIRT1 deacetylase activity and increased P65 acetylation. However the increased osmotic concentration inhibited LPS induced inflammatory response and TNFα mRNA expression. In vitro treatment of primary human monocytes with increased concentrations of D-glucose resulted in increased secretion of a number of inflammatory cytokines and increased expression of TNFα mRNA. Treatment also resulted in decreased intracellular NAD+:NADH ratio and increased binding of acetylated P65 to the TNFα promoter region. In vitro treatments of primary monocytes also replicated the altered expression of the microRNAs 146a-5p and miR-424-5p, as seen in obese individuals. In conclusion a number of changes in monocyte function were observed in response to obesity and treatment with high concentrations of D-glucose. These may lead to the dysregulation of inflammatory responses contributing to the development of co-morbidities.

Caracterização de um homólogo de HINT1 em cana-de-açúcar encontrado em bibliotecas subtrativas de CDNA para floração

The sugarcane is a monocot plant grown in tropical and subtropical regions, with Brazil being the largest producer. Despite its economic importance, little is known about the molecular flowering process in sugarcane. This physiological process can promote a loss up to 60% in sugar or bioethanol. Thus, this work had as objective characterize a HINT1 homologous gene previously identified in subtractive libraries of flowering. Genomic analysis of gene and promoter region structure allowed the observation that there are at least two distinct genes homologous to HINT on sugarcane. Bioinformatics analyses showed the conservation of the characteristic protein domain of HIT superfamily and indicate a phylogenetic relationship associated to cell location. Moreover, a possible relation with the SBTILISIN-like protein family through the information available in interatomas was observed. This suggests that the HINT gene of sugarcane can be related to plant development, there are several possibilities of interactions in the regulation of floral induction process, because the sequences present in regulatory regions indicate that differential expression of HINT was related to with climatic factors in the Northeast region of Brazil as well as to biotic stress and phytohormones. Furthermore, the sugarcane phenotypes indicate that the influence of HINT may happen due to product accumulation of its enzymatic activity. For these characteristics this gene can be used as a marker in the selection of new varieties.

Regulation of Pygopus (hPygo2) expression in prostate cancer by E74-Like factor 1 (Elf-1) transcription factor

Prostate cancer is a worldwide health concern. Pygopus2 (hPygo2) protein is required for growth in breast, ovarian, cervical and prostate cancer. hPygo2 expression is regulated by the Rb protein via the ETS factor Elf-1 in cervical and breast cancer. Additionally, the ETS family has confirmed roles in carcinogenesis and proliferation. The mechanism of hPygo2 expression has not been elucidated in prostate cancer. My hypothesis proposes that hPygo2 expression is regulated by Elf-1 bound to its promoter region. Prostate cancer cell lines were used to show protein levels of hPygo2, Elf-1 and ETS. ChIP assays confirmed varying binding capability of Elf-1 and ETS factors to the proximal promoter region between cell lines. Elf-1 knockdown experiments were performed, results show no change in hPygo2 protein levels but show reduction in 22Rv1 mRNA levels. These results suggest that Elf-1 might not be exclusively involved in the activation of Pygopus expression in prostate cancer.

Predicting Transcript Production Rates in Yeast With Sparse Linear Models

To provide biological insights into transcriptional regulation, a couple of groups have recently presented models relating the promoter DNA-bound transcription factors (TFs) to downstream gene’s mean transcript level or transcript production rates over time. However, transcript production is dynamic in response to changes of TF concentrations over time. Also, TFs are not the only factors binding to promoters; other DNA binding factors (DBFs) bind as well, especially nucleosomes, resulting in competition between DBFs for binding at same genomic location. Additionally, not only TFs, but also some other elements regulate transcription. Within core promoter, various regulatory elements influence RNAPII recruitment, PIC formation, RNAPII searching for TSS, and RNAPII initiating transcription. Moreover, it is proposed that downstream from TSS, nucleosomes resist RNAPII elongation.

Here, we provide a machine learning framework to predict transcript production rates from DNA sequences. We applied this framework in the S. cerevisiae yeast for two scenarios: a) to predict the dynamic transcript production rate during the cell cycle for native promoters; b) to predict the mean transcript production rate over time for synthetic promoters. As far as we know, our framework is the first successful attempt to have a model that can predict dynamic transcript production rates from DNA sequences only: with cell cycle data set, we got Pearson correlation coefficient Cp = 0.751 and coefficient of determination r2 = 0.564 on test set for predicting dynamic transcript production rate over time. Also, for DREAM6 Gene Promoter Expression Prediction challenge, our fitted model outperformed all participant teams, best of all teams, and a model combining best team’s k-mer based sequence features and another paper’s biologically mechanistic features, in terms of all scoring metrics.

Moreover, our framework shows its capability of identifying generalizable fea- tures by interpreting the highly predictive models, and thereby provide support for associated hypothesized mechanisms about transcriptional regulation. With the learned sparse linear models, we got results supporting the following biological insights: a) TFs govern the probability of RNAPII recruitment and initiation possibly through interactions with PIC components and transcription cofactors; b) the core promoter amplifies the transcript production probably by influencing PIC formation, RNAPII recruitment, DNA melting, RNAPII searching for and selecting TSS, releasing RNAPII from general transcription factors, and thereby initiation; c) there is strong transcriptional synergy between TFs and core promoter elements; d) the regulatory elements within core promoter region are more than TATA box and nucleosome free region, suggesting the existence of still unidentified TAF-dependent and cofactor-dependent core promoter elements in yeast S. cerevisiae; e) nucleosome occupancy is helpful for representing +1 and -1 nucleosomes’ regulatory roles on transcription.

Soft tissue sarcoma: biology and therapeutic correlates

Soft tissue sarcomas (STS) comprise a heterogenenous group of greater than 50 malignancies of putative mesenchymal cell origin and as such they may arise in diverse tissue types in various anatomical locations throughout the whole body. Collectively they account for approximately 1% of all human malignancies yet have a spectrum of aggressive behaviours amongst their subtypes. They thus pose a particular challenge to manage and remain an under investigated group of cancers with no generally applicable new therapies in the past 40 years and an overall 5-year survival rate that remains stagnant at around 50%. From September 2000 to July 2006 I undertook a full time post-doctoral level research fellowship at the MD Anderson Cancer Center, Houston, Texas, USA in the department of Surgical Oncology to investigate the biology of soft tissue sarcoma and test novel anti- sarcoma adenovirus-based therapy in the preclinical nude rat model of isolated limb perfusion against human sarcoma xenografts. This work, in collaboration with colleagues as indicated herein, led to a number of publications in the scientific literature furthering our understanding of the malignant phenotype of sarcoma and reported preclinical studies with wild-type p53, in a replication deficient adenovirus vector, and oncolytic adenoviruses administered by isolated limb perfusion. Additional collaborative and pioneering preclinical studies reported the molecular imaging of sarcoma response to systemically delivered therapeutic phage RGD-4c AAVP. Doxorubicin chemotherapy is the single most active broadly applicable anti-sarcoma chemotherapeutic yet only has an approximate 30% overall response rate with additional breakthrough tumour progression and recurrence after initial chemo-responsiveness further problematic features in STS management. Doxorubicin is a substrate for the multi- drug resistance (mdr) gene product p-glycoprotein drug efflux pump and exerts its main mode of action by induction of DNA double-strand breaks during the S-phase of the cell cycle. Two papers in my thesis characterise different aspects of chemoresistance in sarcoma. The first shows that wild-type p53 suppresses Protein Kinase Calpha (PKCα) phosphorylation (and activation) of p-glycoprotein by transcriptional repression of PKCα through a Sp-1 transcription factor binding site in its -244/-234 promoter region. The second paper demonstrates that Rad51 (a central mediator of homologous recombination repair of double strand breaks) has elevated levels in sarcoma and particularly in the S- G2 phase of the cell cycle. Suppression of Rad51 with small interfering RNA in sarcoma cell culture led to doxorubicin chemosensitisation. Reintroduction of wild-type p53 into STS cell lines resulted in decreased Rad51 protein and mRNA expression via transcriptional repression of the Rad51 promoter through increased AP-2 binding. In light of poor response rates to chemotherapy, escape from local control portends a poor prognosis for patients with sarcoma. Two papers in my thesis characterise aspects of sarcoma angiogenesis, invasion and metastasis. Human sarcoma samples were found to have high levels of matrix metalloproteinase-9 (MMP-9) with expression levels that correlated with p53 mutational status. MMP-9 is known to degrade extracellular collagen, contribute to the control of the angiogenic switch necessary in primary tumour progression and facilitate invasion and metastasis. Reconstitution of wild-type p53 function led to decreased levels of MMP-9 protein and mRNA as well as zymography-assessed MMP-9 proteolytic activity and decreased tumour cell invasiveness. Reintroduction of wild-type p53 into human sarcoma xenografts in-vivo decreased tumour growth and MMP-9 protein expression. Wild-type p53 was found to suppress mmp-9 transcription via decreased binding of NF-κB to its -607/-595 mmp-9 promoter element. Studies on the role of the VEGF165 in sarcoma found that sarcoma cells stably transfected with VEGF165 formed more aggressive xenografted tumours with increased vascularity, growth rate, metastasis, and resistance to chemotherapy. Use of the anti-VEGFR2 antibody DC101 enhanced doxorubicin sensitivity at sub-conventional dosing, inhibited tumour growth, decreased development of metastases, and reduced tumour micro-vessel density while increasing the vessel maturation index. These effects were explained primarily through effects on endothelial cells (e.c.s), rather than the tumour cells per se, where DC101 induced e.c. sensitivity to doxorubicin and suppressed e.c. production of MMPs. The p53 tumour suppressor pathway is the most frequently mutated pathway in sarcoma. Recapitulation of wild-type p53 function in sarcoma exerts a number of anti-cancer outcomes such as growth arrest, resensitisation to chemotherapy, suppression of invasion, and attenuation of angiogenesis. Using a modified nude rat-human sarcoma xenograft model for isolated limb perfusion (ILP) delivery of wild-type p53 in a replication deficient adenovirus vector I showed that functionally competent wild-type p53 could be delivered to and detected in human leiomyosarcoma xenografts confirming preclinical feasibility - although not efficacious due to low transgene expression. Viral fibre modification to express the RGD tripeptide motif led to greater viral uptake by sarcoma cells in vitro (transductional targeting) and changing the transgene promoter to a response element active in cells with active telomerase expression restricted the transgene expression to the tumour intracellular environment (transcriptional targeting). Delivery of the fibre-modified, selectively replication proficient oncolytic adenovirus Ad.hTC.GFP/ E1a.RGD by ILP demonstrated a more robust, and tumour-restricted, transgene expression with evidence of anti-sarcoma effect confirmed microscopically. Collaborative studies using the fibre modified phage RGD-4C AAVP confirmed that systemic delivery specifically, efficiently, and repeatedly targets human sarcoma xenografts, binds to αv integrins in tumours, and demonstrates a durable, though heterogeneous, transgene expression of 1-4 weeks. Incorporation of the Herpes Simplex Virus thymidine kinase (HSVtk) transgene into RGD-4C AAVP permitted CT-PET spatial and temporal molecular imaging in vivo of transgene expression and allowed quantification of tumour metabolic activity both before and after interval administration of a systemic cytotoxic with predictable and measurable response to treatment before becoming apparent clinically. These papers further the medical and scientific community’s understanding of the biology of soft tissue sarcoma and report preclinical studies with novel and promising anti- sarcoma therapeutics.

Association of the solute carrier family 11 member 1 gene polymorphisms with susceptibility to leprosy in a Brazilian sample

Natural resistance-associated macrophage protein 1/solute carrier family 11 member 1 gene (Nramp1/Slc11a1) is a gene that controls the susceptibility of inbred mice to intracellular pathogens. Polymorphisms in the human Slc11a1/Nramp1 gene have been associated with host susceptibility to leprosy. This study has evaluated nine polymorphisms of the Slc11a1/Nramp1 gene [(GT)n, 274C/T, 469+14G/C, 577-18G/A, 823C/T, 1029 C/T, 1465-85G/A, 1703G/A, and 1729+55del4] in 86 leprosy patients (67 and 19 patients had the multibacillary and the paucibacillary clinical forms of the disease, respectively), and 239 healthy controls matched by age, gender, and ethnicity. The frequency of allele 2 of the (GT)n polymorphism was higher in leprosy patients [p = 0.04, odds ratio (OR) = 1.49], whereas the frequency of allele 3 was higher in the control group (p = 0.03; OR = 0.66). Patients carrying the 274T allele (p = 0.04; OR = 1.49) and TT homozygosis (p = 0.02; OR = 2.46), such as the 469+14C allele (p = 0.03; OR = 1.53) of the 274C/T and 469+14G/C polymorphisms, respectively, were more frequent in the leprosy group. The leprosy and control groups had similar frequency of the 577-18G/A, 823C/T, 1029C/T, 1465-85G/A, 1703G/A, and 1729+55del4 polymorphisms. The 274C/T polymorphism in exon 3 and the 469+14G/C polymorphism in intron 4 were associated with susceptibility to leprosy, while the allele 2 and 3 of the (GT)n polymorphism in the promoter region were associated with susceptibility and protection to leprosy, respectively.

Rs266882 polymorphism analysis in KLK3 gene by RFLPPCR in cases of prostate cancer

Poster presented at the From Basic Sciences to Clinical Research - First International Congress of CiiEM. Egas Moniz, Caparica, Portugal, 27-28 November 2015

Association of the TNF-alpha -308 G/A polymorphisms with metabolic responses secondary to a high protein/low carbohydrate versus a standard hypocaloric diet

Background: Mutation analysis has identified a G-> A transition in the promoter region of TNF-alpha gene at position -308 (rs1800629). Objective: The aim of our study was to investigate the influence of polymorphism in -308 GA promoter variant of the TNF alpha gene on metabolic response and weight loss secondary to two hypocaloric diets. Method: A sample of 283 obese subjects was enrolled in a consecutive prospective way. In the basal visit, patients were randomly allocated during 9 months to diet HP (high protein/low carbohydrate hypocaloric diet) and diet S (standard hypocaloric diet). Results: There were no significant differences between the positive effects on weight loss in either genotype group with both diets. With both diets and only in wild genotype (diet HP vs. diet S), total cholesterol (-9.1 ± 3.4 mg/dL vs. -6.9 ± 2.0 mg/dL; p > 0.05), LDL cholesterol (-9.0 ± 2.9 mg/dL vs. -6.5 ± 2.1 mg/dL; p > 0.05) and triglycerides (-23.1 ± 5.1 mg/dL vs. -12.3 ± 4.8 mg/dL; p < 0.05) decreased. The improvement in triglycerides was higher in subjects without A allele. With diet HP and only in wild genotype, insulin levels (-3.1 ± 1.8 UI/L; p < 0.05) and HOMA-R (-0.8 ± 0.1 units; p < 0.05) decreased. Conclusion: Carriers of -308 GG promoter variant of TNF-alpha gene have a better metabolic response than -308 GA obese with a high protein hypocaloric diet.

Arrangement of gene pairs, retrotransposon insertions, and regulation of gene expression in plants

Plant genomes are extremely complex. Myriad factors contribute to their evolution and organization, as well as to the expression and regulation of individual genes. Here we present investigations into several such factors and their influence on genome structure and gene expression: the arrangement of pairs of physically adjacent genes, retrotransposons closely associated with genes, and the effect of retrotransposons on gene pair evolution. All sequenced plant genomes contain a significant fraction of retrotransposons, including that of rice. We investigated the effects of retrotransposons within rice genes and within a 1 kb putative promoter region upstream of each gene. We found that approximately one-sixth of all rice genes are closely associated with retrotransposons. Insertions within a gene’s promoter region tend to block gene expression, while retrotransposons within genes promote the existence of alternative splicing forms. We also identified several other trends in retrotransposon insertion and its effects on gene expression. Several studies have previously noted a connection among genes between physical proximity and correlated expression profiles. To determine the degree to which this correlation depends on an exact physical arrangement, we studied the expression and interspecies conservation of convergent and divergent gene pairs in rice, Arabidopsis, and Populus trichocarpa. Correlated expression among gene pairs was quite common in all three species, yet conserved arrangement was rare. However, conservation of gene pair arrangement was significantly more common among pairs with strongly correlated expression levels. In order to uncover additional properties of gene pair conservation and rearrangement, we performed a comparative analysis of convergent, divergent, and tandem gene pairs in rice, sorghum, maize, and Brachypodium. We noted considerable differences between gene pair types and species. We also constructed a putative evolutionary history for each pair, which led to several interesting discoveries. To further elucidate the causes of gene pair conservation and rearrangement, we identified retrotransposon insertions in and near rice gene pairs. Retrotransposon-associated pairs are less likely to be conserved, although there are significant differences in the possible effect of different types and locations of retrotransposon insertions. The three types of gene pair also varied in their susceptibility to retrotransposon-associated evolutionary changes.

Polymorphism of the p38 beta gene in patients with colorectal cancer

The p38 mitogen‑activated protein kinase (MAPK) signaling pathways have been proposed to participate in the pathological process of cancer by affecting inflammation, proliferation, metastasis and cell survival. A single nucleotide polymorphism (SNP; rs2235356, ‑1628A→G) in the promoter region of the p38β gene has been proposed as a genetic modifier for colorectal cancer (CRC) in a Chinese population. The present study evaluated the susceptibility of patients possessing this SNP to CRC, in addition to determining its association with clinical parameters in Swedish patients with CRC. Using the LightSNiP genotyping assay, this SNP was screened in 389 patients with CRC and 517 control subjects. No significant difference in the genotype distribution or in the allelic frequencies was identified between the two groups nor was any association identified with the clinical parameters. These findings indicate that the ‑1628A→G polymorphism of the p38β gene is not significantly associated with a susceptibility to CRC in a Swedish population.

Upstream regulatory region of zebrafish lunatic fringe: Isolation and promoter analysis

Lunatic fringe (Lfng), one modulator of Notch signaling, plays an essential part in demarcation of tissues boundaries during animal early development, especially somitogenesis. To characterize the promoter of zebrafish 1fng and generate somite-specific transgenic zebrafish, we isolated the upstream regulatory region of zebrafish 1fng by blast search at the Ensembl genome database (http://www. ensembl.org) and analyzed the promoter activity using green fluorescent protein (GFP) as a reporter. Promoter activity assay in zebrafish shows that the 0.2-kb fragment containing GC-box, CAAT-box, and TATA-box can direct tissue-specific GFP expression, while the 0.4-kb and 1.2-kb fragments with further upstream sequence included drive GFP expression more efficiently. We produced 1fngEGFP-transgenic founders showing somite-specific expression of GFP and consequently generated a hemizygous 1fngEGFP-transgenic line. The eggs from 1fngEGFP-transgenic female zebrafish show strong GFP expression, which is consistent to the reverse-transcription polymerase chain reaction PCR (RT-PCR) detection of 1fng transcripts in the fertilized eggs. This reveals that zebrafish 1fng is a maternal factor existing in matured eggs, suggesting that fish somitogcnesis may be influenced by maternal factors.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^