Caracterização molecular de isolados de Flavobacterium columnare de tilapia do nilo e piracanjuba por meio de RAPD-PCR

Flavobacterium columnare is a cosmopolite bacteria and it is one of the main problem in Brazilian aquaculture, causing high mortalities index and economic damage. The main factors that contribute to columnaris disease are inadequate water quality, excess handling, high density of fish and temperature variations. For a successful epidemiological study and disease control, it is essential to differentiate the F. columnare from other yellow pigmentation bacteria. The present study used molecular techniques to characterize, by RAPD-PCR, two strains of F. columnare isolated from Oreochromis niloticus and Brycon orbignyanus. Data were analyzed as binary (0 and 1) and a genetic similarity matrix was generated by Jaccard's coefficient. Cluster analysis was performed by the neighbor joining method. The RAPD-PCR technique confirmed to be a usefull tool to obtain genetic profiles from F. columnare isolates based on the oligonucleotides used and to verify genetic similarity.

First isolation and molecular characterization of Toxoplasma gondii from finishing pigs from São Paulo State, Brazil

Toxoplasma gondii infection is widely prevalent in humans in Brazil. Among the food animals, pigs are considered the most important meat source of T. gondii for infection in humans. In the present study, we report the first isolation of viable T. gondii from finishing pigs in Brazil. Antibodies to T. gondii were found in 49 (17%) of 286 pigs prior slaughter using the modified agglutination test (MAT) at a serum dilution of 1:25. Attempts were made to isolate T. gondii from 28 seropositive pigs. Samples of heart, brain, and tongue from each pig were pooled, digested in acid pepsin, and bioassayed in five mice per pig. Viable T. gondii was isolated from seven pigs; all isolates were lethal for mice. Restriction fragment length polymorphism on products of SAG2 locus amplified by PCR revealed that two isolates were Type I and five were Type III. The results indicate that phenotypically and genetically T. gondii isolates from pigs from Brazil are distinct from isolates of T gondii from pigs in the USA. (c) 2005 Elsevier B.V. All rights reserved.

Um sistema computacional para diagnosticar viroses de plantas usando a técnica de PCR com construção de primers espécie-específicos

It proposes a established computational solution in the development of a software to construct species-specific primers, used to improve the diagnosis of virus of plant for PCR. Primers are indispensable to PCR reaction, besides providing the specificity of the diagnosis. Primer is a synthetic, short, single stranded piece of DNA, used as a starter in PCR technique. It flanks the sequence desired to amplify. Species-specific primers indicate the well known region of beginning and ending where the polymerase enzyme is going to amplify on a certain species, i.e. it is specific for only a species. Thus, the main objective of this work is to automatize the process of choice of primers, optimizing the specificity of chosen primers by the traditional method

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Isolation, solubility and in vitro hydrolysis of chickpea vicilin-like protein

The chickpea vicilin-like globulin was isolated and chromatographed on Sepharose CL-6B and Sephacryl S-300. The native globulin with a molecular weight of 140 kDa was resolved in Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in seven polypeptide bands in the range of 12.4-67 kDa. The solubility profile of the protein in water and NaCl solutions was typical of a legume globulin. The purified vicilin-like globulin, native and heated, was hydrolyzed by pepsin, trypsin and chymotrypsin. The hydrolysis patterns indicated that the native vicilin-like protein was only partially degraded by the enzymes in comparison with casein. Heating increased its susceptibility to hydrolysis relative to the native form, for all the enzymes. However, the results obtained by the pH-drop method revealed that the in vitro digestibility of the vicilin-like protein was not altered by heating, while 11 S-like and total globulins suffered a small increase, indicating that the structural characteristics of storage globulins may be important factors limiting the protein digestion. (c) 2007 Swiss Society of Food Science and Technology. Published by Elsevier Ltd. All rights reserved.

Detection of nontuberculous mycobacteria from water buffalo raw milk in Brazil

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Strains of Xylella fastidiosa rapidly distinguished by arbitrarily primed-PCR

Genomic DNAs isolated from strains of Xylella fastidiosa that caused citrus variegated chlorosis, coffee leaf scorch, Pierce's Disease of grapevine, and plum leaf scorch were analyzed by arbitrarily primed polymerase chain reaction. Purified DNA was amplified under nonstringent conditions with single primers 21 nucleotides (nt) long. Thirty-nine amplification products were observed that were useful to distinguish among the strains and to derive a similarity matrix and construct a phenogram showing possible relationships among the strains. Strains isolated from diseased coffee and citrus in Brazil were closely related to each other (coefficient of similarity of 0.872), but only distantly related to a strain isolated from diseased grapevine in the USA (coefficient of similarity of 0.650). Strains of Xylella fastidiosa isolated from diseased plums in the USA and Brazil clustered with strains from different hosts isolated from their respective countries of origin. Thus, there may be two quite dissimilar clusters of strains of Xylella fastidiosa, one in North America and the other in South America. Each cluster contains strains that can cause disease in plum. The methods described provide a convenient and rapid method to distinguish between strains of Xylella fastidiosa that cause diseases of coffee and citrus in the same region of Brazil. This has not been possible previously. This will potentially enable the two strains to be distinguished in alternate hosts or in insect vectors.

Mycobacterium bovis identification by a molecular method from post-mortem inspected cattle obtained in abattoirs of Mato Grosso do Sul, Brazil

The presence of Mycobacterium bovis in bovine carcasses with lesions suggestive of tuberculosis was evaluated. Seventy-two carcass samples were selected during slaughter inspection procedures in abattoirs in the state of Mato Grosso do Sul, Brazil. Seventeen (23.6%) of samples showed colonies suggestive of mycobacteria that were confirmed to be acid-fast bacilli by Ziehl-Neelsen staining. Polymerase chain reaction (PCR) using primers specific for M. bovis identified M. bovis in 13 (76.5%) isolates. The PCR-restriction enzyme pattern analysis using gene encoding for the 65-kDa protein and two restriction enzymes identified the remaining four isolates that were represented by two M. tuberculosis complex and two nontuberculous mycobacteria. The results are indicative of infection of slaughter cattle by M. bovis and other mycobacteria in the state of Mato Grosso do Sul.

Molecular assay optimized by Taguchi experimental design method for venous thromboembolism investigation

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Multidimensional cluster stability analysis from a Brazilian Bradyrhizobium sp RFLP/PCR data set

The taxonomy of the N(2)-fixing bacteria belonging to the genus Bradyrhizobium is still poorly refined, mainly due to conflicting results obtained by the analysis of the phenotypic and genotypic properties. This paper presents an application of a method aiming at the identification of possible new clusters within a Brazilian collection of 119 Bradryrhizobium strains showing phenotypic characteristics of B. japonicum and B. elkanii. The stability was studied as a function of the number of restriction enzymes used in the RFLP-PCR analysis of three ribosomal regions with three restriction enzymes per region. The method proposed here uses Clustering algorithms with distances calculated by average-linkage clustering. Introducing perturbations using sub-sampling techniques makes the stability analysis. The method showed efficacy in the grouping of the species B. japonicum and B. elkanii. Furthermore, two new clusters were clearly defined, indicating possible new species, and sub-clusters within each detected cluster. (C) 2008 Elsevier B.V. All rights reserved.

Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR)

Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card) e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina), para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR). Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad); Insta Gene® (BioRad) e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb), Factor V Leiden (220 pb) e Abelson (106 pb). de acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.

A rapid, environmentally friendly, and reliable method for pesticide analysis in high-fat samples

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Direct Detection of Mycobacterium bovis in Bovine Lymph Nodes by PCR

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Molecular detection of Streptococcus agalactiae in bovine raw milk samples obtained directly from bulk tanks

Mastitis is the most common infectious disease affecting dairy cattle; in addition, it remains the most economically important disease of dairy industries around the world. Streptococcus agalactiae, a contagious pathogen associated with subclinical mastitis, is highly infectious. This bacterium can cause an increase in bulk tank bacterial counts (BTBC) and bulk tank somatic cell counts (BTSCC). The microbiological identification of S. agalactiae in samples from bulk tanks is an auxiliary method to control contagious mastitis. Thus, there are some limitations for time-consuming cultures or identification methods and additional concerns about the conservation and transport of samples. Bulk tank samples from 247 dairy farms were cultured and compared through polymerase chain reaction (PCR), directed to 16S rRNA genes of S. agalactiae, followed by BTBC and S. agalactiae isolation. The mean value of BTBC was 1.08 x 10(6) CFU mL(-1) and the bacterium was identified through the microbiological method in 98 (39.7%; CI95% = 33.8-45.9%) and through PCR in 110 (44.5%; CI95% = 38.5-50.8%) samples. Results indicated sensitivity of 0.8571 +/- 0.0353 (CI95% = 0.7719-0.9196) and specificity of 0.8255 +/- 0.0311 (CI95% = 0.7549-0.8827). The lack of significant difference between microbiological and molecular results (kappa = 0.6686 +/- 0.0477 and CI95% = 0.5752-0.7620) indicated substantial agreement between the methods. This suggests that PCR can be used for bulk tank samples to detect contagious mastitis caused by S. agalactiae. (C) 2011 Elsevier Ltd. All rights reserved.

Correlação dos achados clínicos e hematológicos com diagnóstico definitivo de erliquiose canina por meio de PCR

The Ehrlichiosis is a worldwide diseases of great importance in a veterinary medicine is an important infectious diseases whose prevalence has increased significant in the last year in the Brazilian states. Due to the fact that this study was designed to correlate the findings hematological clinical signs and PCR, being the most sensitive. This study evaluated twenty dogs seen at veterinary hospital UNESP - Botucatu campus during the 03 from august to September 28 2009. Animal cited 65% were positive in the PCR test. Among the most prominent clinical findings 76.92% (10/13) with anorexia, 53.84% (7/13) with hepatoesplenomegaly, 46.15% (6/13) with apathy and 38.46% (5/13) epistaxis. The thirteen animals positive PCR 92.30% (12/13) showed thrombocytopenia (<150.000 platelets) e 61.53 (8/13) anemic (<5.50 x10). Thus, we conclude that the PCR was a good method for detection differential canine ehrlichiosis may be adopted together with the clinical and hematological findings for the accurate diagnosis of the disease.