Isolation and molecular identification of Fusobacterium nucleatum from Nigerian patients with oro-facial infections.

Fusobacterium nucleatum is one of the most common anaerobic bacteria present in the oral cavity and is often isolated from infections involving other body sites. To characterise F. nucleatum strains from patients attending a teaching hospital in Nigeria in order to provide information on the methods for accurate identification of anaerobes in clinical specimen. Fusobacterium nucleatum specie from 50 patients presenting with oro-facial infections were studied by culture on Fusobacterium selective agar and fastidious anaerobe agar. The isolates were characterised based on colonial morphology, microscopy, lipase production, susceptibility to kanamycin and colistin and resistance to vancomycin. Biochemical tests were performed using a commercial test kit. The identity of the isolates was confirmed based on molecular characterization performed using polymerase chain reaction (PCR) analysis. Forty-eight (96%) F. nucleatum isolates were obtained from the 50 patients by culture and all the isolates were identified by colonial appearance and microscopy based on their unique spindle shape with tapered ends. Only 26 (54.2%) of the 48 isolates were identified by commercial API 20A test kit while PCR confirmed the identity of all the isolates. Anaerobes are involved in human infections and their study is quite cumbersome due to tedious nature and high cost of the techniques involved. Cultural method is reliable in the isolation and identification of F. nucleatum species. PCR is a rapid and simple method that can complement the phenotypic identification of anaerobes and would assist in their full identification.

Characterization of Primary Isolates of HIV Type 1 CRF28_BF, CRF29_BF, and Unique BF Recombinants Circulating in Sao Paulo, Brazil

We report for the first time the genetic and biological characterization of 10 HIV-1 primary isolates representing CRF28_BF and CRF29_BF together with additional unique BF recombinant forms (URFs) obtained by PBMC cocultivation. Recombination is an important factor promoting the increase in the genetic diversity of HIV-1. Notably, more than 20% of HIV-1 sequences worldwide were recombinants. Several recombinant viruses were reported in Brazil, and six circulating recombinant forms (CRFs) have been identified (CRF28_BF, CRF29_BF, CRF31_BC, CRF39_BF, CRF40_BF, and CRF46_BF). CRF28_BF and CRF29_BF were found to infect almost 30% of the patients in Sao Paulo State. The near full-length genomes of these 10 primary isolates were amplified by nested PCR in three overlapping segments, purified, and sequenced. Three samples were related to CRF28_BF, three to CRF29_BF, and four were unique recombinant forms (URFs), as determined by their breakpoint profile determined with the jpHMM program. Additionally, the coreceptor usage of these isolates was investigated in vitro using GHOST assays, which revealed three dual-tropic (X4/R5) viruses, four lymphotropic (X4) viruses, and three macrophage-tropic (R5) viruses with different V3-loop motifs, which challenges the notion that GWGR-carrying viruses are macrophage-tropic only. In sum, we report a much-anticipated well-characterized panel of viruses representing CRF28_BF, CRF29_BF, and URFs from Sao Paulo State, Brazil.

Epidemiological, parasitological and molecular aspects of Giardia duodenalis infection in children attending public daycare centers in southeastern Brazil

The purpose of this study was to determine the prevalence, associated risk factors and genotype of Giardia duodenalis infection in children attending public daycare centers in the city of Araguari, state of Minas Gerais, Brazil. Fecal samples were collected from 245 children aged 0-5 years, and questionnaires were asked about sociodemographic and hygiene-related characteristics. At the daycare centers where children tested positive, fecal samples were collected from the staff handling food, and from family members and domestic animals. Positive samples were analyzed at the dehydrogenase glutamate (gdh) locus to determine the genotype. The prevalence of G. duodenalis was 51.8%, and drinking unfiltered and unboiled water (OR 2.12, CI 1.26-3.69, p<0.001) and washing hands only with water (OR 2.14, Cl 1.19-4.04, p<0.001) were related risk factors. No association was found between test-positive children anti their family members, domestic animals and food handlers. An analysis of the sequences of 30 samples revealed that they all belonged to genotype B. (C) 2012 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

Molecular epidemiology of extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae over a 10 year period in Calgary, Canada

A study was designed to investigate the molecular epidemiology of extended-spectrum -lactamase (ESBL)-producing Klebsiella pneumoniae isolated in a centralized region over a 10 year period (200009). Molecular characterization was done using isoelectric focusing, PCR and sequencing for bla(CTX-M), bla(TEM) and bla(SHV) genes and plasmid-mediated quinolone resistance determinants. Genetic relatedness was determined with PFGE using XbaI and multilocus sequencing typing. A total of 89 patients with incident infections were identified; the majority presented with hospital-onset urinary tract infections. The absolute number of ESBL-producing isolates remained very low until 2003, increased slightly in 2004, remained stable until 2008 and then in 2009 there was an abrupt increase in the numbers of ESBL producers identified. The majority of K. pneumoniae produced CTX-M-14 and -15, and have replaced SHV-12-producing isolates since 2005. We identified four different major sequence types (STs) among 32 of isolates (i.e. ST17, ST20, and the new ST573 and ST575) and provided insight into their clinical and molecular characteristics. The ST isolates were more likely to produce community-onset infections, were associated with bla(CTX-M) and emerged during the latter part of the study period. ST17 produced CTX-M-15 and SHV-12, and was more likely to be positive for qnrB; ST20 produced CTX-M-14 and was positive for qnrS. The multiresistant ST575 that produced CTX-M-15 appeared in 2009. Our study highlights the importance of molecular epidemiology in providing insight into the emergence, characteristics and distribution of STs among ESBL-producing K. pneumoniae.

Characterization and exploiment of Microbial Strains to be used in Meat Processing and Fermentation

The principal aim of this research project has been the evaluation of the specific role of yeasts in ripening processes of dry-cured meat products, i.e. speck and in salami produced by adding Lactobacilli starter cultures, i.e. L. sakei, L. casei, L. fermentum, L. rhamnosus, L.sakei + S.xylosus. In particular the contribution of the predominant yeasts to the hydrolytic patterns of meat proteins has been studied both in model system and in real products. In fact, although several papers have been published on the microbial, enzymatic, aromatic and chemical characterization of dry-cured meat e.g. ham over ripening, the specific role of yeasts has been often underestimated. Therefore this research work has been focused on the following aspects: 1. Characterization of the yeasts and lactic acid bacteria in samples of speck produced by different farms and analyzed during the various production and ripening phases 2. Characterization of the superficial or internal yeasts population in salami produced with or without the use of lactobacilli as starter cultures 3. Molecular characterization of different strains of yeasts and detection of the dominant biotypes able to survive despite environmental stress factors (such as smoke, salt) 4. Study of the proteolytic profiles of speck and salami during the ripening process and comparison with the proteolytic profiles produced in meat model systems by a relevant number of yeasts isolated from speck and salami 5. Study of the proteolytic profiles of Lactobacilli starter cultures in meat model systems 6. Comparative statistical analysis of the proteolytic profiles to find possible relationships between specific bands and peptides and specific microorganisms 7. Evaluation of the aromatic characteristics of speck and salami to assess relationships among the metabolites released by the starter cultures or the dominant microflora

Phenotypic characterization of the epithelial and myoepithelial components in canine and feline mammary tumours

In veterinary medicine, the ability to classify mammary tumours based on the molecular profile and also determine whether the immunophenotype of the regional lymph node and/or systemic metastases is equal to that of the primary tumor may be predictive on the estimation of the effectiveness of various cancer treatments that can be scheduled. Therefore, aims, developed as projects, of the past three years have been (1) to define the molecular phenotype of feline mammary carcinomas and their lymph node metastases according to a previous modified algorithm and to demonstrate the concordance or discordance of the molecular profile between the primary tumour and lymph node metastasis, (2) to analyze, in female dogs, the relationship between the primary mammary tumor and its lymph node metastasis based on immunohistochemical molecular characterization in order to develop the most specific prognostic-predictive models and targeted therapeutic options, and (3) to evaluate the molecular trend of cancer from its primary location to systemic metastases in three cats and two dogs with mammary tumors. The studies on mammary tumours, particularly in dogs, have drawn gradually increasing attention not exclusively to the epithelial component, but also to the myoepithelial cells. The lack of complete information on a valid panel of markers for the identification of these cells in the normal and neoplastic mammary gland and lack of investigation of immunohistochemical changes from an epithelial to a mesenchymal phenotype, was the aim of a parallel research. While investigating mammary tumours, it was noticed that only few studies had focused on the expression of CD117. Therefore, it was decided to further deepen the knowledge in order to characterize the immunohistochemical staining of CD117 in normal and neoplastic mammary tissue of the dog, and to correlate CD117 immunohistochemical results with mammary histotype, histological stage (invasiveness), Ki67 index and patient survival time.

Molecular epidemiology of the nasal colonization by methicillin-susceptible Staphylococcus aureus in Swiss children

Nasal carriage of Staphylococcus aureus contributes to an increased risk of developing an infection with the same bacterial strain. Genetic regulatory elements and toxin-expressing genes are virulence factors associated with the pathogenic potential of S. aureus. We undertook an extensive molecular characterization of methicillin-susceptible S. aureus (MSSA) carried by children. MSSA were recovered from the nostrils of children. The presence of Panton-Valentine leukocidin (PVL), exfoliatins A and B (exfoA and exfoB), and the toxic-shock staphylococcal toxin (TSST-1) and agr group typing were determined by quantitative PCR. A multiple-locus variable-number of tandem repeat analysis (MLVA) assay was also performed for genotyping. Five hundred and seventy-two strains of MSSA were analysed. Overall, 30% were positive for toxin-expressing genes: 29% contained one toxin and 1.6% two toxins. The most commonly detected toxin gene was tst, which was present in 145 (25%) strains. The TSST-1 gene was significantly associated with the agr group 3 (OR 56.8, 95% CI 32.0-100.8). MLVA analysis revealed a large diversity of genetic content and no clonal relationship was demonstrated among the analysed MSSA strains. Multilocus sequence typing confirmed this observation of diversity and identified ST45 as a frequent colonizer. This broad diversity in MSSA carriage strains suggests a limited selection pressure in our geographical area.

Neuropathological and molecular comparison between clinical and asymptomatic bovine spongiform encephalopathy cases

Interest in the proper neuropathological and molecular characterization of bovine spongiform encephalopathy (BSE) has increased since asymptomatic and atypical cases were detected in the cattle population by active disease surveillance. In this respect we investigated a total of 95 confirmed BSE cases originating from different active and passive surveillance categories (clinical suspects, emergency-slaughter, fallen stock and routinely slaughter) in Switzerland for their neuropathological and molecular phenotype. We looked for measurable differences between these categories in lesion profile, severity of spongiform change, degree of astrocytosis as well as immunohistochemical and molecular patterns of the disease-associated isoform of the prion protein (PrPd) in the caudal brainstem. Our results indicate significantly higher intensities of spongiform change in clinically affected compared to asymptomatic BSE cases. Similar effects were in trend observed for the intensities of PrPd deposition and astrocytosis, whereas the frequencies of morphological PrPd types and the molecular patterns in Western immunoblot were not different. Importantly, none of the animals included in this study revealed features of atypical BSE. Taken together, this study suggests that both clinically affected as well as asymptomatic Swiss BSE cases in cattle share the neuropathological and molecular phenotype of classical BSE and that asymptomatic classical BSE cases are at a pre-clinical stage of the disease rather than representing a true sub-clinical form of BSE.

Molecular structure of antibodies against small ligands

Antibodies which bind bioactive ligands can serve as a template for the generation of a second antibody which may react with the physiological receptor. This phenomenon of molecular mimicry by antibodies has been described in a variety of systems. In order to understand the chemical and molecular mechanisms involved in these interactions, monoclonal antibodies directed against two pharmacologically active alkaloids, morphine and nicotine, were carefully studied using experimental and theoretical molecular modeling techniques. The molecular characterization of these antibodies involved binding studies with ligand analogs and determination of the variable region amino acid sequence. A three-dimensional model of the anti-morphine binding site was constructed using computational and graphics display techniques. The antibody response in BALB/c mice to morphine appears relatively restricted, in that all of the antibodies examined in this study contained a $\lambda$ light chain, which is normally found in only 5% of mouse immunoglobulins. This study represents the first use of theoretical and experimental modeling techniques to describe the antigen binding site of a mouse Fv region containing a $\lambda$ light chain. The binding site model indicates that a charged glutamic acid residue and aromatic side chains are key features in ionic and hydrophobic interactions with the ligand morphine. A glutamic acid residue is found in the identical position in the anti-nicotine antibody and may play a role in binding nicotine. ^

Characterization of the human tissue transglutaminase gene promoter

Transglutaminases are a family of calcium-dependent enzymes, that catalyze the covalent cross-linking of proteins by forming $\varepsilon(\gamma$-glutamyl)lysine isopeptide bonds. In order to investigate the molecular mechanisms regulating the expression of the tissue transglutaminase gene and to determine its biological functions, the goal of this research has been to clone and characterize the human tissue transglutaminase promoter. Thirteen clones of the tissue transglutaminase gene were obtained from the screening of a human placental genomic DNA library. A 1.74 Kb fragment derived from DNA located immediately upstream of the translation start site was subcloned and sequenced. Sequence analysis of this DNA fragment revealed that it contains a TATA box (TATAA), a CAAT box (GGACAAT), and a series of potential transcription factor binding sites and hormone response elements. Four regions of significant homology, a GC-rich region, a TG-rich region, an AG-rich region, and HR1, were identified by aligning 1.8 Kb of DNA flanking the human, mouse, and guinea pig tissue transglutaminase genes.^ To measure promoter activity, we subcloned the 1.74 Kb fragment of the tissue transglutaminase gene into a luciferase reporter vector to generate transglutaminase promoter/luciferase reporter constructs. Transfection experiments showed that this DNA segment includes a functional promoter with high constitutive activity. Deletion analysis revealed that the SP1 sites or corresponding sequences contribute to this activity. We investigated the role of DNA methylation in regulating the activity of the promoter and found that in vitro methylation of tissue transglutaminase promoter/luciferase reporter constructs suppressed their basal activity. Methylation of the promoter is inversely correlated with the expression of the tissue transglutaminase gene in vivo. These results suggest that DNA methylation may be one of the mechanisms regulating the expression of the gene. The tumor suppressor gene product p53 was also shown to inhibit the activity of the promoter, suggesting that induction of the tissue transglutaminase gene is not involved in the p53-dependent programmed cell death pathway. Although retinoids regulate the expression of the tissue transglutaminase gene in vivo, retinoid-inducible activity can not be identified in 3.7 Kb of DNA 5$\sp\prime$ to the tissue transglutaminase gene.^ The structure of the 5$\sp\prime$ end of the tissue transglutaminase gene was mapped. Alignment analysis of the human tissue transglutaminase gene with other human transglutaminases showed that tissue transglutaminase is the simplest member of transglutaminase superfamily. Transglutaminase genes show a conserved core of exons and introns but diverse N-terminuses and promoters. These observations suggest that key regulatory sequences and promoter elements have been appended upstream of the core transglutaminase gene to generate the diversity of regulated expression and regulated activity characteristic of the transglutaminase gene family. ^

Characterization of cytochrome P450 4F subfamily: Response in traumatic brain injury and gene regulation

CYP4F enzymes metabolize endogenous molecules including arachidonic acid, leukotrienes and prostaglandins. The involvement of these eisosanoids in inflammation has led to the hypothesis that CYP4Fs may modulate inflammatory conditions after traumatic brain injury (TBI). In rat, TBI elicited changes in mRNA expression of CYP4Fs as a function of time in the cerebrum region. These changes in CYP4F mRNA levels inversely correlated with the cerebral leukotriene B4 (LTB4) level following injury at the same time points. TBI also resulted in changes in CYP4F protein expression and localization around the injury site, where CYP4F1 and CYP4F6 immunoreactivity increased in surrounding astrocytes and CYP4F4 immunoreactivity shifted from endothelia of cerebral vessels to astrocytes. The study with rat primary astrocytes indicated that pro-inflammatory cytokines TNFα and IL-1β could affect the transcription of CYP4Fs to a certain degree, whereas the changing pattern in the primary astrocytes appeared to be different from that in the in vivo TBI model.^ In addition, the regulation of CYP4F genes has been an unsolved issue although factors including cytokines and fatty acids appear to affect CYP4Fs expression in multiple models. In this project, HaCaT cells were used as an in vitro cellular model to define signaling pathways involved in the regulation of human CYP4F genes. Retinoic acids inhibited CYP4F11 expression, whereas cytokines TNFα and IL-1β induced transcription of CYP4F11 in HaCaT cells. The induction of CYP4F11 by both cytokines could be blocked by a JNK specific inhibitor, indicating the involvement of the JNK pathway in the up-regulation of CYP4F11. Retinoic acids are known to function in gene regulation through nuclear receptors RARs and RXRs. The RXR agonist LG268 greatly induced transcription of CYP4F11, whereas RAR agonist TTNPB obviously inhibited CYP4F11 transcription, indicating that the down-regulation of CYP4F11 by retinoic acid was mediated by RARs, and that inhibition of CYP4F11 by retinoic acid may also be related to the competition for RXR receptors. Thus, the CYP4F11 gene is regulated by signaling pathways including the RXR pathway and the JNK pathway. In contrast, the regulation mechanism of other CYP4Fs by retinoic acids appears to be different from that of CYP4F11.^

Characterization of the MLC box: A conserved {\it cis\/}-acting DNA element present in the chicken MLC1s/1c gene

The slow/cardiac alkali myosin light chain (MLC1s/1c) is a member of a multigene family whose protein products are essential for activation of the myosin ATPase. In the adult, the MLC1s/1c isoform is expressed in both cardiac and slow-twitch skeletal muscles, while it is expressed by all skeletal muscles during development.^ To elucidate the molecular mechanisms that underlie the transcriptional regulation of MLC1s/1c gene expression, the immediate 5$\sp\prime$ flanking region of the gene was isolated and shown to be capable of directing reporter gene expression. Analysis of this region revealed a 110 bp muscle-specific enhancer that includes a myocyte-specific enhancer-binding factor 2 (MEF-2) site, E-boxes, which are potential binding sites for the basic-helix-loop-helix proteins such as MyoD, and a MLC box. The focus of the thesis was to identify the role of the MLC box in expression of the MLC1s/1c gene.^ The MLC box is a member of the family of CArG box containing cis-acting DNA elements. Mutagenesis showed that the MLC box is necessary, but not sufficient, for the expression of a reporter gene linked to the 5$\sp\prime$ flanking region of the MLC1s/1c gene. Linker scanner and site-directed mutagenesis identified a number of potential sites within the 110 bp muscle-specific enhancer that may cooperate with the MLC box. These are the MEF-2 site, the E-box site, and a 10 bp element located upstream of the MEF-2 site that does not have sequence similarity with any known cis-acting element. The MLC box is capable of binding to factors present in muscle nuclear extracts, as well as to human recombinant serum response factor (SRF). Binding of SRF to the MLC box was correlated with the ability of the 5$\sp\prime$ flanking region of the MLC1s/1c gene to drive reporter gene expression. Results suggest a model in which binding of SRF to the MLC box activates expression of the MLC1s/1c gene while binding of the factors present in the nuclear extracts suppresses the expression of the gene. (Abstract shortened with permission of author.) ^

Molecular studies of human high grade B cell non -Hodgkin's lymphomas

The non-Hodgkin's B cell lymphomas are a diverse group of neoplastic diseases. The incidence rate of the malignant tumors has been rising rapidly over the past twenty years in the United States and worldwide. The lack of insight to pathogenesis of the disease poses a significant problem in the early detection and effective treatment of the human malignancies. These studies attempted to investigate the molecular basis of pathogenesis of the human high grade B cell non-Hodgkin's lymphomas with a reverse genetic approach. The specific objective was to clone gene(s) which may play roles in development and progression of human high grade B cell non-Hodgkin's lymphomas.^ The messenger RNAs from two high grade B cell lymphoma lines, CJ and RR, were used for construction of cDNA libraries. Differential screening of the derived cDNA libraries yielded a 1.4 kb cDNA clone. The gene, designated as NHL-B1.4, was shown to be highly amplified and over-expressed in the high grade B cell lymphoma lines. It was not expressed in the peripheral blood lymphoid cells from normal donors. However, it was inducible in peripheral blood T lymphocytes by a T cell mitogen, PHA, but could not be activated in normal B cells by B cell mitogen PMA. Further molecular characterization revealed that the gene may have been rearranged in the RR and some other B cell lymphoma lines. The coding capacity of the cDNA has been confirmed by a rabbit reticulocyte lysate and wheat germ protein synthesis system. A recombinant protein with a molecular weight of approximate 30 kDa was visualized in autoradiogram. Polyclonal antisera have been generated by immunization of two rabbits with the NHL-B1.4 recombinant protein produced in the E. coli JM109. The derived antibody can recognize a natural protein with molecular weight of 49 kDa in cell lysate of activated peripheral T lymphocytes of normal donors and both the cell lysate and supernatant of RR B cell lymphoma lines. The possible biologic functions of the molecule has been tested preliminarily in a B lymphocyte proliferation assay. It was found that the Q-sepharose chromatograph purified supernatant of COS cell transfection could increase tritiated thymidine uptake by B lymphocytes but not by T lymphocytes. The B cell stimulatory activity of the supernatant of COS cell tranfection could be neutralized by the polyclonal antisera, indicating that the NHL-B1.4 gene product may be a molecule with BCGF-like activity.^ The expression profiles of NHL-B1.4 in normal and neoplastic lymphoid cells were consistent with the current B lymphocyte activation model and autocrine hypothesis of high grade B cell lymphomagenesis. These results suggested that the NHL-B1.4 cDNA may be a disease-related gene of human high grade B cell lymphomas, which may codes for a postulated B cell autocrine growth factor. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Characterization of the cholesterol 7$\alpha$-hydroxylase promoter in hypercholesterolemia -resistant rabbits

Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^