996 resultados para INDUCED EXPANSION


Relevância:

20.00% 20.00%

Publicador:

Resumo:

In critically ill patients, it is important to predict which patients will have their systemic blood flow increased in response to volume expansion to avoid undesired hypovolemia and fluid overloading. Static parameters such as the central venous pressure, the pulmonary arterial occlusion pressure, and the left ventricular end-diastolic dimension cannot accurately discriminate between responders and nonresponders to a fluid challenge. In this regard, respiratory-induced changes in arterial pulse pressure have been demonstrated to accurately predict preload responsiveness in mechanically ventilated patients. Some experimental and clinical studies confirm the usefulness of arterial pulse pressure as a useful tool to guide fluid therapy in critically ill patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Carbon dioxide (CO(2)) has been used in the food industry as an antimicrobial agent. This study aimed to investigate whether CO(2) pneumoperitoneum might act similarly as an antimicrobial agent in the infected peritoneal cavity. Peritonitis was induced in 58 rats by intraabdominal injection of an Escherichia coli inoculum (6 x 105 colony-forming units [CFU]/ml). Control rats were injected with saline solution. The rats were randomly divided into four groups: rat control (RC, n = 15), bacterial inoculation control (BIC, n = 10), bacterial inoculation and laparotomy (BIL, n = 17), and bacterial inoculation and CO(2) pneumoperitoneum (BIP, n = 16). The survival rates and histopathologic changes in the abdominal wall muscles, spleen, liver, intestines, and omentum were evaluated, and the samples were classified as ""preserved"" or ""inflamed"" (acute inflammation or tissue regeneration). The survival rates for the four groups were as follows: RC (100%), BIP (75%), BIL (53%), and BIC (30%). With regard to survival rates, statistically significant differences were observed between the following groups: RC and BIC (p = 0.0009), RC and BIL (p = 0.0045), BIP and BIC (p = 0.0332), and RC and BIP (p = 0.0470). No significant differences regarding survival rates were observed between the BIL and BIC groups or between the BIP and BIL groups. With regard to the number of inflamed samples per group, a statistically significant difference was observed between the BIC and RC groups and the BIL and RC groups (p = 0.05). Carbon dioxide pneumoperitoneum has a protective effect against bacterial peritonitis induced in rats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Different hemodynamic parameters including static indicators of cardiac preload as right ventricular end-diastolic volume index (RVEDVI) and dynamic parameters as pulse pressure variation (PPV) have been used in the decision-making process regarding volume expansion in critically ill patients. The objective of this study was to compare fluid resuscitation guided by either PPV or RVEDVI after experimentally induced hemorrhagic shock. Methods: Twenty-six anesthetized and mechanically ventilated pigs were allocated into control (group I), PPV (group II), or RVEDVI (group III) group. Hemorrhagic shock was induced by blood withdrawal to target mean arterial pressure of 40 mm Hg, maintained for 60 minutes. Parameters were measured at baseline, time of shock, 60 minutes after shock, immediately after resuscitation with hydroxyethyl starch 6% (130/0.4), 1 hour and 2 hours thereafter. The endpoint of fluid resuscitation was determined as the baseline values of PPV and RVEDVI. Statistical analysis of data was based on analysis of variance for repeated measures followed by the Bonferroni test (p < 0.05). Results: Volume and time to resuscitation were higher in group III than in group II (group III = 1,305 +/- 331 mL and group II = 965 +/- 245 mL, p < 0.05; and group III = 24.8 +/- 4.7 minutes and group II = 8.8 +/- 1.3 minutes, p < 0.05, respectively). All static and dynamic parameters and biomarkers of tissue oxygenation were affected by hemorrhagic shock and nearly all parameters were restored after resuscitation in both groups. Conclusion: In the proposed model of hemorrhagic shock, resuscitation to the established endpoints was achieved within a smaller amount of time and with less volume when guided by PPV than when guided by pulmonary artery catheter-derived RVEDVI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: The use of springs in cranial expansion has demonstrated to be effective for craniosynostosis treatment. The spring-exerted expansile action has been observed when springs are placed both in the sagittal and parasagittal regions, mainly in scaphocephaly. In this study, a variation in cephalometric measurements under expansible spring action on the skull base was analyzed. Methods: Thirteen 4-week-old New Zealand white rabbits were divided into 4 groups: group 1, in which only amalgam markers were used (control); group 2, in which amalgam markers were used, and a sagittal suturectomy was performed; group 3, in which amalgam markers were used, and a sagittal suturectomy was performed with placement of expansible springs in the interparietal region; and group 4, in which markers were used, and a linear parasagittal craniectomy was performed with spring placement. All animals were killed at weeks 2, 4, 8, and 12. Radiologic control with cephalometric study was performed. Results: Distraction of amalgam markers in the groups with springs was greater than in those without springs. A proportional change in the angles measured through craniometry was observed in these groups. Conclusions: The experimental rabbit model was shown to be adequate to the analysis proposed by the study. Under the action of springs, the groups with sagittal and parasagittal osteotomy were found to present a similar distraction of amalgam markers. A concomitant change in cephalometric measurements occurred, suggesting a change in the skull base mediated by expansible springs placed both in the sutural and nonsutural sites.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective. The objective of this study was to evaluate, using computed tomography, correlations between Hyrax appliance opening and post-SARPE skeletal changes. Study design. Fifteen patients underwent SARPE according to a specific protocol and were followed. Linear and angular measurements of the anterior, intermediate, and posterior portions of the maxilla were evaluated. The correlation between maxillary expansion and appliance opening was investigated. Results. Significant overall expansion was observed. In the anterior and intermediate portions of the maxilla, the increase in maxillary width was greater than that observed in the posterior portion. The degree of appliance opening was significantly greater than that of the skeletal expansion. Also, no linear correlation between appliance opening and regional maxillary expansion was established. Conclusion. The transverse expansion of the maxilla was less than uniform. The lack of linear correlation between appliance opening and skeletal expansion is attributable to multiple factors, including those related to the device, the surgical technique, and the craniofacial deformity itself. (Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2008; 106: 812-819)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: The bladder is normally impermeable to possible hostile environmental factors and toxic urinary wastes. Any disruption of the permeability barrier would permit the leakage of urine constituents into the underlying cells layers and subsequent inflammation. Protamine sulfate, which increases urothelial permeability, is used in experimental models of cystitis. We examined whether protamine sulfate alone could cause bladder inflammation or if the association of protamine sulfate and urine is needed for this condition. Materials and Methods: Female Wistar rats (Center for the Development of Experimental Models for Medicine and Biology, Federal University of Sao Paulo, Sao Paulo, Brazil) had the bladder catheterized and instilled with protamine sulfate (10 mg) or sterile saline for 30 minutes. To exclude urine other groups of rats underwent bilateral nephrectomy and the same procedure was used. One day after instillation the bladders were removed for histopathology. Edema and vascular congestion were graded from 0-none to 3-severe. Polymorphonuclear and mast cells were counted. The Kruskal-Wallis test was performed for statistical analysis. Results: Intravesical instillation of protamine sulfate in nonnephrectomized rats led to inflammation, in contrast to findings in rats instilled with saline. On the other hand, nephrectomized rats showed no inflammatory changes following the instillation of protamine sulfate or saline. The mast cell count was similar in all groups. Conclusions: Bladder inflammation in this experimental model of urothelial injury was not due to protamine sulfate alone. The association of protamine sulfate and urine was necessary to trigger the inflammatory cascade. Thus, urine indeed has an important role in the development of bladder inflammation in an environment of higher urothelial permeability.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Odorant-induced currents in mammalian olfactory receptor neurons have proved difficult to obtain reliably using conventional whole-cell recording. By using a mathematical model of the electrical circuit of the patch and rest-of-cell, we demonstrate how cell-attached patch measurements can be used to quantitatively analyze responses to odorants or a high (100 mM) K+ solution. High K+ induced an immediate current flux from cell to pipette, which was modeled as a depolarization of similar to 52 mV, close to that expected from the Nernst equation (56 mV), and no change in the patch conductance. By contrast, a cocktail of cAMP-stimulating odorants induced a current flux from pipette into cell following a significant (4-10 s) delay. This was modeled as an average patch conductance increase of 36 pS and a depolarization of 13 mV, Odorant-induced single channels had a conductance of 16 pS. In cells bathed with no Mg2+ and 0.25 mM Ca2+, odorants induced a current flow from cell to pipette, which was modeled as a patch conductance increase of similar to 115 pS and depolarization of similar to 32 mV, All these results are consistent with cAMP-gated cation channels dominating the odorant response, This approach, which provides useful estimates of odorant-induced voltage and conductance changes, is applicable to similar measurements in any small cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel flow-tagging technique is presented which was employed to measure gas velocities in the free stream of a shock tube. This method is based on the laser spectroscopic techniques of Laser-Enhanced Ionisation (LEI) and Laser-Induced Fluorescence (LIF). The flow in the shock tube is seeded with small amounts of sodium, and LEI is used to produce a substantial depletion of neutral sodium atom concentration in a well-defined region of the flow, by using two wavelength-resonance excitation and subsequent collisional ionisation. At a specific time delay, single-laser-pulse planar LIF is utilised to produce a two-dimensional (2-D) inverse image of the depleted tagged region downstream of the flow. By measuring the displacement of the tagged region, free stream velocities in a shock tube were determined. Large variations in the concentration of sodium seeded into the flow were observed and even in the presence of these large variations accurate free-stream velocity measurements were obtained. The experimentally determined value for velocity compares very well with the predicted velocity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Field studies have shown that the elevation of the beach groundwater table varies with the tide and such variations affect significantly beach erosion or accretion. In this paper, we present a BEM (Boundary Element Method) model for simulating the tidal fluctuation of the beach groundwater table. The model solves the two-dimensional flow equation subject to free and moving boundary conditions, including the seepage dynamics at the beach face. The simulated seepage faces were found to agree with the predictions of a simple model (Turner, 1993). The advantage of the present model is, however, that it can be used with little modification to simulate more complicated cases, e.g., surface recharge from rainfall and drainage in the aquifer may be included (the latter is related to beach dewatering technique). The model also simulated well the field data of Nielsen (1990). In particular, the model replicated three distinct features of local water table fluctuations: steep rising phase versus flat falling phase, amplitude attenuation and phase lagging.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of natural killer (NK) T cells in the development of lupus-like disease in mice is still controversial. We treated NZB/W mice with anti-NK1.1 monoclonal antibodies (mAbs) and our results revealed that administration of either an irrelevant immunoglobulin G2a (IgG2a) mAb or an IgG2a anti-NK1.1 mAb increased the production of anti-dsDNA antibodies in young NZB/W mice. However, the continuous administration of an anti-NK1.1 mAb protected aged NZB/W mice from glomerular injury, leading to prolonged survival and stabilization of the proteinuria. Conversely, the administration of the control IgG2a mAb led to an aggravation of the lupus-like disease. Augmented titres of anti-dsDNA in NZB/W mice, upon IgG2a administration, correlated with the production of BAFF/BLyS by dendritic, B and T cells. Treatment with an anti-NK1.1 mAb reduced the levels of interleukin-16, produced by T cells, in spleen cell culture supernatants from aged NZB/W. Adoptive transfer of NK T cells from aged to young NZB/W accelerated the production of anti-dsDNA in recipient NZB/W mice, suggesting that NK T cells from aged NZB/W are endowed with a B-cell helper activity. In vitro studies, using purified NK T cells from aged NZB/W, showed that these cells provided helper B-cell activity for the production of anti-dsDNA. We concluded that NK T cells are involved in the progression of lupus-like disease in mature NZB/W mice and that immunoglobulin of the IgG2a isotype has an enhancing effect on antibody synthesis due to the induction of BAFF/BLyS, and therefore have a deleterious effect in the NZB/W mouse physiology.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The importance of lung tissue in asthma pathophysiology has been recently recognized. Although nitric oxide mediates smooth muscle tonus control in airways, its effects on lung tissue responsiveness have not been investigated previously. We hypothesized that chronic nitric oxide synthase (NOS) inhibition by N-omega-nitro-L-arginine methyl ester (L-NAME) may modulate lung tissue mechanics and eosinophil and extracellular matrix remodeling in guinea pigs with chronic pulmonary inflammation. Animals were submitted to seven saline or ovalbumin exposures with increasing doses (1 similar to 5 mg/ml for 4 wk) and treated or not with L-NAME in drinking water. After the seventh inhalation (72 h), animals were anesthetized and exsanguinated, and oscillatory mechanics of lung tissue strips were performed in baseline condition and after ovalbumin challenge (0.1%). Using morphometry, we assessed the density of eosinophils, neuronal NOS (nNOS)- and inducible NOS (iNOS)-positive distal lung cells, smooth muscle cells, as well as collagen and elastic fibers in lung tissue. Ovalbumin-exposed animals had an increase in baseline and maximal tissue resistance and elastance, eosinophil density, nNOS- and iNOS-positive cells, the amount of collagen and elastic fibers, and isoprostane-8-PGF(2 alpha) expression in the alveolar septa compared with controls (P < 0.05). L-NAME treatment in ovalbumin-exposed animals attenuated lung tissue mechanical responses (P < 0.01), nNOS- and iNOS-positive cells, elastic fiber content (P < 0.001), and isoprostane-8-PGF(2 alpha) in the alveolar septa (P < 0.001). However, this treatment did not affect the total number of eosinophils and collagen deposition. These data suggest that NO contributes to distal lung parenchyma constriction and to elastic fiber deposition in this model. One possibility may be related to the effects of NO activating the oxidative stress pathway.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Sepsis induces a systemic inflammatory response leading to tissue damage and cell death. LPS tolerance affects inflammatory response. To comprehend potential new mechanisms of immune regulation in endotoxemia, we examined macrophage mRNA expression by macroarray affected by LPS tolerance. LPS tolerance was induced with subcutaneous administration of 1 mg/kg/day of LPS over 5 days. Macrophages were isolated from the spleen and the expression of 1200 genes was quantitatively analyzed by the macroarray technique. The tolerant group displayed relevant changes in the expression of 84 mRNA when compared to naive mice. A functional group of genes related to cell death regulation was identified. PARP-1, caspase 3, FASL and TRAIL genes were confirmed by RT-PCR to present lower expression in tolerant mice. In addition, reduced expression of the pro-inflammatory genes TNF-alpha and IFN-gamma in the tolerant group was demonstrated. Following this, animals were challenged with polymicrobial sepsis. Flow cytometry analysis showed reduced necrosis and apoptosis in macrophages from the tolerant group compared to the naive group. Finally, a survival study showed a significant reduction in mortality in the tolerant group. Thus, in the current study we provide evidence for the selective reprogramming of the gene expression of cell death pathways during LPS tolerance and link these changes to protection from cell death and enhanced survival rates. (C) 2010 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aim of the study: This study assessed the involvement of endogenous glucocorticoids (GCs) in the anti-arthritic properties of bee venom (BV) on antigen-induced arthritis (AIA) in rabbits. Materials and methods: BV (1.5-6 mu g/kg/day) was injected for 7 days before AIA induction, whereas the control group received sterile saline. The total and differential leukocyte count. PGE(2) levels in synovial fluid and synovial membrane cell infiltrate were evaluated. The contribution of GCs to BV action was assessed in rabbits treated with BV plus metyrapone, an inhibitor of GC synthesis, or RU-38 486, a steroid antagonist. Results: Treatment with BV (1.5 mu g/kg/day) reduced the leukocyte count and PGE2 level (18571 +/- 1909 cells/mm(3) and 0.49 +/- 0.05 ng/mL, respectively) as well as the cellular infiltrate compared with the control group (40968 +/- 5248 cells/mm(3) and 2.92 +/- 0.68 ng/mL, p < 0.05). The addition of metyrapone to BV treatment completely reversed the inhibition of AIA, whereas RU-38 486 was ineffective. Conclusion: Our data show that bee venom treatment prevents the development of antigen-induced arthritis in rabbits through the action of GCs. (C) 2010 Elsevier Ireland Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A line of FVB (H-2(q)) mice transgenic for the E6/E7 open reading frames of Human Papillomavirus type 16 driven from the alpha-A crystallin promoter expresses E7 mRNA in lens and skin epithelium. E7 protein is detectable in adult skin, coinciding with the development or inflammatory skin disease, which progresses to papillomata and squamous carcinomata in some mice. By examining the outcome of parenteral immunization with E7 protein, we sought to determine whether endogenous expression of E7 in skin had induced a preexisting immune outcome, i.e., specific immunity or tolerance, or whether the mice remain naive (''ignorant'') to E7. Our data show that the antibody response to defined E7 B-epitopes, the proliferative response to Th epitopes, and the delayed-type hypersensitivity (DTH) response to whole E7 did not differ between groups or young and old E6/E7 transgenic mice (likely having different degrees of lifetime exposure to E7 protein) or between E6/E7-transgenic and nontransgenic parental strain control mice. Although an E7-specific CTL response could not be induced in the H-2(q) background of these mice, incorporation of a D-b allele into the genome allowed comparison of D-b-restricted CTL responses in E6/E7 transgenic and nontransgenic mice. Experiments indicated that the E7-immunization-induced CTL response did not differ significantly between E6/E7 transgenic and nontransgenic mice. We interpret these results to indicate that in spite of expression of E7 protein in adult skin, E6/E7 transgenic mice remain immunologically naive (ignorant) of E7 epitopes presented by immunization. (C) 1997 Academic Press.