Gastric hypomotility following epicardial vagal denervation ablation to treat atrial fibrillation

Gastric Palsy Following AF Vagal Ablation. We report a case of a 55-year-old man with vagal paroxysmal atrial fibrillation (AF) who was submitted to selective epicardial and endocardial atrial vagal denervation with the objective of treating AF. Radiofrequency pulses were applied on epicardial and endocardial surface of the left atrium close to right pulmonary veins (PVs) and also on epicardial surface close to left inferior PV. Following the procedure, patient presented with symptoms of gastroparesis, which was documented on CT scan and gastric emptying scintigraphy. Symptoms were transient and the patient recovered completely.

Atrial Coronary Arteries in Areas Involved in Atrial Fibrillation Catheter Ablation

Background-The proximity to vascular structures is a limiting factor during radiofrequency ablation. However, little or no attention has been given to the atrial arterial circulation during the development of atrial fibrillation (AF) catheter ablation techniques. Methods and Results-We examined the atrial arterial circulation in areas involved in AF ablation in 24 heart specimens by colored resin injection and careful dissection. The sinus node artery (SNA) arose from the circumflex artery in 42% of case; proximal to the LA appendage in 29%, crossing the left atrium (LA) anterior wall; and after the LA appendage in the remaining 13%, crossing the mitral isthmus and passing close to the left pulmonary veins (PVs), the LA roof, and the right superior PV. In 58%, the SNA arose from the right coronary artery. Major arteries (>= 1 mm in external diameter) were found in the mitral isthmus in 54%, at the LA roof in 54%, and at the LA anterior wall in 29%. Around the left PV ostia, there were areas with major arteries in up to 37% (at the roof and inferior segments) and around the right PV ostia in up to 29% (at the roof segment). Conclusions-Major atrial coronary arteries, including the SNA, were commonly found in the areas involved in AF ablation and could cause difficulties in obtaining transmural lesions and electric isolation or even lead to ischemic sinus node or atrial dysfunction. (Circ Arrhythm Electrophysiol. 2010;3:600-605.)

The expression of TLR9 in human cutaneous leishmaniasis is associated with granuloma

P>The Toll-like receptor (TLR) signalling pathway is the first system that defends against Leishmania. After recognising Leishmania as nonself, TLRs trigger NF-kappa B expression. NF-kappa B proceeds to the nucleus and promotes the transcription of pro-inflammatory cytokines. TLR9 is thus an important factor in the induction of an effective immune response against Leishmania. We examined the pattern of TLR9 expression in 12 patients with cutaneous leishmaniasis caused by Leishmania braziliensis detected by polymerase chain reaction. Normal skin was analysed as a negative control. TLR9 expression was examined in the dermis and epidermis by immunohistochemical analysis of paraffin-embedded biopsy tissue. TLR9 expression was primarily observed in the granuloma. The protein was detected in a few cells in the dermis. A lower expression level was detected in the epidermis of patients with leishmaniasis when compared with normal skin. The presence of TLR9 in the skin of patients with cutaneous leishmaniasis is associated with granuloma and expressed by macrophages.

Biological activity and metabolic clearance of recombinant human follicle stimulating hormone produced in Sp2/0 myeloma cells

Human follicle stimulating hormone is a pituitary glycoprotein that is essential for the maintenance of ovarian follicle development and testicular spermatogenesis. Like other members of the glycoprotein hormone family, it contains a common a subunit and a hormone specific beta subunit. Each subunit contains two glycosylation sites. The specific structures of the oligosaccharides of human follicle stimulating hormone have been shown to influence both the in vitro and in vivo bioactivity. Since the carbohydrate structure of a protein reflects the glycosylation apparatus of the host cells in which the protein is expressed, we examined the isoform profiles, in vitro bioactivity and metabolic clearance of a preparation of purified recombinant human follicle stimulating hormone derived from a stable, transfected Sp2/0 myeloma cell line, and pituitary human follicle stimulating hormone. Isoelectric focussing and chromatofocussing studies of human follicle stimulating hormone preparations both showed a more basic isoform profile for the recombinant human follicle stimulating hormone compared to that of pituitary human follicle stimulating hormone. The recombinant human follicle stimulating hormone had a significantly higher radioreceptor activity compared to that of pituitary human follicle stimulating hormone, consistent with a greater in vitro potency. Pharmacokinetic studies in rats indicated a similar terminal half life (124 min) to that of the pituitary human follicle stimulating hormone (119 min). Preliminary carbohydrate analysis showed recombinant human follicle stimulating hormone to contain high mannose and/or hybrid type, in addition to complex type carbohydrate chains, terminating with both alpha 2,3 and alpha 2,6 linked sialic acids. These results demonstrate that recombinant human follicle stimulating hormone made in the Sp2/0 myeloma cells is sialylated, has a more basic isoform profile, and has a greater in vitro biological potency compared to those of the pituitary human follicle stimulating hormone.

Processing of mutated human proinsulin to mature insulin in the non-endocrine cell line, CHO

Heterologous genes encoding proproteins, including proinsulin, generally produce mature protein when expressed in endocrine cells while unprocessed or partially processed protein is produced in non-endocrine cells. Proproteins, which are normally processed in the regulated pathway restricted to endocrine cells, do not always contain the recognition sequence for cleavage by furin, the endoprotease specific to the constitutive pathway, the principal protein processing pathway in non-endocrine cells. Human proinsulin consists of B-Chain-C-peptide-A-Chain and cleavage at the B/C and C/A junctions is required for processing. The B/C, but not the C/A junction, is recognised and cleaved in the constitutive pathway. We expressed a human proinsulin and a mutated proinsulin gene with an engineered furin recognition sequence at the C/A junction and compared the processing efficiency of the mutant and native proinsulin in Chinese Hamster Ovary cells. The processing efficiency of the mutant proinsulin was 56% relative to 0.7% for native proinsulin. However, despite similar levels of mRNA being expressed in both cell lines, the absolute levels of immunoreactive insulin, normalized against mRNA levels, were 18-fold lower in the mutant proinsulin-expressing cells. As a result, there was only a marginal increase in absolute levels of insulin produced by these cells. This unexpected finding may result from preferential degradation of insulin in non-endocrine cells which lack the protection offered by the secretory granules found in endocrine cells.

Mathematical constraints on a theory of human memory - Response

Colonius suggests that, in using standard set theory as the language in which to express our computational-level theory of human memory, we would need to violate the axiom of foundation in order to express meaningful memory bindings in which a context is identical to an item in the list. We circumvent Colonius's objection by allowing that a list item may serve as a label for a context without being identical to that context. This debate serves to highlight the value of specifying memory operations in set theoretic notation, as it would have been difficult if not impossible to formulate such an objection at the algorithmic level.

Reconstruction of large cranial defects in nonimmunosuppressed experimental design with human dental pulp stem cells

The main aim of this study is to evaluate the capacity of human dental pulp stem cells (hDPSC), isolated from deciduous teeth, to reconstruct large-sized cranial bone defects in nonimmunosuppressed (NIS) rats. To our knowledge, these cells were not used before in similar experiments. We performed two symmetric full-thickness cranial defects (5 x 8 mm) on each parietal region of eight NIS rats. In six of them, the left side was supplied with collagen membrane only and the right side (RS) with collagen membrane and hDPSC. In two rats, the RS had collagen membrane only and nothing was added at the left side (controls). Cells were used after in vitro characterization as mesenchymal cells. Animals were euthanized at 7, 20, 30, 60, and 120 days postoperatively and cranial tissue samples were taken from the defects for histologic analysis. Analysis of the presence of human cells in the new bone was confirmed by molecular analysis. The hDPSC lineage was positive for the four mesenchymal cell markers tested and showed osteogenic, adipogenic, and myogenic in vitro differentiation. We observed bone formation 1 month after surgery in both sides, but a more mature bone was present in the RS. Human DNA was polymerase chain reaction-amplified only at the RS, indicating that this new bone had human cells. The us e of hDPSC in NIS rats did not cause any graft. rejection. Our findings suggest that hDPSC is an additional cell resource for correcting large cranial defects in rats and constitutes a promising model for reconstruction of human large cranial defects in craniofacial surgery.

Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Evaluation of Maxillary Alveolar Reconstruction Using a Resorbable Collagen Sponge with Recombinant Human Bone Morphogenetic Protein-2 in Cleft Lip and Palate Patients

Introduction: A resorbable collagen matrix with recombinant human bone morphogenetic protein (rhBMP-2) was compared with traditional iliac crest bone graft for the closure of alveolar defects during secondary dental eruption. Methods: Sixteen patients with unilateral cleft lip and palate, aged 8 to 12 years, were selected and randomly assigned to group 1 (rhBMP-2) or group 2 (iliac crest bone graft). Computed tomography was performed to assess both groups preoperatively and at months 6 and 12 postoperatively. Bone height and defect volume were calculated through Osirix Dicom Viewer (Pixmeo, Apple Inc.). Overall morbidity was recorded. Results: Preoperative and follow-up examinations revealed progressive alveolar bone union in all patients. For group 1, final completion of the defect with a 65.0% mean bone height was detected 12 months postoperatively. For group 2, final completion of the defect with an 83.8% mean bone height was detected 6 months postoperatively. Dental eruption routinely occurred in both groups. Clinical complications included significant swelling in three group 1 patients (37.5%) and significant donor-site pain in seven group 2 patients (87.5%). Conclusions: For this select group of patients with immature skeleton, rhBMP-2 therapy resulted in satisfactory bone healing and reduced morbidity compared with traditional iliac crest bone grafting.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Pentoxifylline modifies three-dimensional collagen lattice model contraction and expression of collagen types I and III by human fibroblasts derived from post-burn hypertrophic scars and from normal skin

Fibroblasts are thought to be partially responsible for the persisting contractile forces that result in burn contractures. Using a monolayer cell culture and fibroblast populated collagen lattice (FPCL) three-dimensional model we subjected hypertrophic scar and non-cicatricial fibroblasts to the antifibrogenic agent pentoxifylline (PTF - 1 mg/mL) in order to reduce proliferation, collagen types I and III synthesis and model contraction. Fibroblasts were isolated from post-burn hypertrophic scars (HSHF) and non-scarred skin (NHF). Cells were grown in monolayers or incorporated into FPCL`s and exposed to PTF. In monolayer, cell number proliferation was reduced (46.35% in HSHF group and 37.73% in NHF group, p < 0.0001). PTF selectively inhibited collagen III synthesis in the HSHF group while inhibition was more evident to type I collagen synthesis in the NHF group. PTF also reduced contraction in both (HSHF and NHF) FPCL. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.

Biologically active conformer of the effector region of human C5a and modulatory effects of N-terminal receptor binding determinants on activity

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Serum from children with polyarticular juvenile idiopathic arthritis (pJIA) inhibits differentiation, mineralization and may increase apoptosis of human osteoblasts ""in vitro""

We examined the effects of polyarticular juvenile idiopathic arthritis (pJIA) serum on proliferation, differentiation, mineralization, and apoptosis of human osteoblast cells (hOb) in culture. The hOb were cultured with 10% serum from active pJIA and healthy controls (CT) and were tested for DNA synthesis, alkaline phosphatase (AP) activity, osteocalcin (OC) secretion, calcium levels, caspase 3 activity, and DNA fragmentation. None of the patients had used glucocorticoids for at least 1 month before the study, or any other drug that can affect bone mineral metabolism. Human inflammatory cytokine levels (IL-6, IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70) were measured in pJIA and CT sera. Low levels of AP activity was observed in pJIA cultures compared with CT cultures (67.16 +/- 53.35 vs 100.11 +/- 50.64 mu mol p-nitrophenol/h(-1) mg(-1) protein, P=0.008). There was also a significant decrease in OC secretion (9.23 +/- 5.63 vs 12.82 +/- 7.02 ng/mg protein, P=0.012) and calcium levels (0.475 +/- 0.197 vs 0.717 +/- 0.366 mmol/l, P=0.05) in pJIA hOb cultures. No difference was observed in cell proliferation (323.56 +/- 108.23 vs 328.91 +/- 88.03 dpm/mg protein, P=0.788). Osteoblasts cultured with JIA sera showed lower levels of DNA and increased fragmentation than osteoblasts cultured with CT sera. pJIA sera showed higher IL-6 values than CT (21.44 +/- 9.31 vs 3.58 +/- 2.38 pg/ml, P<0.001), but no difference was observed related to IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70 between pJIA and controls. This study suggests that serum from children with pJIA inhibits differentiation, mineralization and may increase apoptosis of hOb cultures, and inflammatory cytokines such as IL-6 might be a mechanism in this find. These results may represent an alternative therapeutic target for prevention and treatment of bone loss in JIA.