Biogenesis of the C. elegans germline syncytium: from nucleation to maturation

La vie commence par la fusion des gamètes pour générer un zygote, dans lequel les constituants à la fois de l'ovocyte et des spermatozoïdes sont partagés au sein d'un syncytium. Le syncytium consiste en des cellules ou tissus dans lesquels des cellules nucléées individuelles distinctes partagent un cytoplasme commun. Alors que l’avantage du syncytium durant la fécondation est tout à fait évident, les syncytia se produisent également dans de nombreux contextes de développement différents dans les plantes, les champignons et dans le règne animal, des insectes aux humains, pour des raisons qui ne sont pas immédiatement évidentes. Par exemple, la lignée germinale de nombreuses espèces de vertébrés et d'invertébrés, des insectes aux humains, présente une structure syncytiale, suggérant que les syncytia constituent des phases conservées de développement de la lignée germinale. Malgré la prévalence commune des syncytia, ces derniers ont cependant confondu les scientifiques depuis des décennies avec des questions telles que la façon dont ils sont formés et maintenus en concurrence avec leurs homologues diploïdes, et quels sont les avantages et les inconvénients qu'ils apportent. Cette thèse va décrire l'utilisation de la lignée germinale syncytiale de C. elegans afin d'approfondir notre compréhension de l'architecture, la fonction et le mode de formation des tissus syncytiaux. Les cellules germinales (CGs) dans la lignée germinale de C. elegans sont interconnectées les unes aux autres par l'intermédiaire de structures appelées des anneaux de CG. En utilisant l'imagerie des cellules vivantes, nous avons d'abord analysé l'architecture syncytiale de la lignée germinale au long du développement et démontré que la maturation de l'anneau de CG se produit progressivement au cours de la croissance des larves et que les anneaux de CG sont composés de myosine II, de l'anilline canonique ANI-1, et de la courte isoforme d’anilline ANI-2, qui n'a pas les domaines de liaison à l’actine et à la myosine, depuis le premier stade larvaire, L1. Parmi les composants de l'anneau de CG, ANI-2 est exprimé au cours du développement et exclusivement enrichi entre les deux CGs primordiales (CGPs) au cours de l'embryogenèse de C. elegans, indiquant qu’ANI-2 est un composant bona fide des anneaux de CG. Nous avons en outre montré que les anneaux de CG sont largement absents dans les animaux mutants pour ani-2, montrant que leur maintien repose sur l'activité d'ANI-2. Contrairement à cela, nous avons trouvé que la déplétion d’ANI-1 a augmenté à la fois le diamètre des anneaux de CG et la largeur du rachis. Fait intéressant, la déplétion d’ANI-1 dans les mutants d’ani-2 a sauvé les défauts d'anneaux de CG des gonades déficientes en ani-2, ce qui suggère que l'architecture syncytiale de la lignée germinale de C. elegans repose sur un équilibre de l'activité de ces deux protéines Anilline. En outre, nous avons montré que lors de leur entrée à l'âge adulte, les mutants ani-2 présentent de sévères défauts de multinucléation des CGs qui découlent de l'effondrement des membranes de séparation des CGs individuelles. Cette multinucléation a coïncidé avec le début de la diffusion cytoplasmique, dont le blocage réduit la multinucléation des gonades mutantes pour ani-2, suggérant que les anneaux de CG résistent au stress mécanique associé au processus de diffusion cytoplasmique. En accord avec cela, nous avons trouvé aussi que la gonade peut soutenir la déformation élastique en réponse au stress mécanique et que cette propriété repose sur la malléabilité des anneaux de CGs. Dans une étude séparée afin de comprendre le mécanisme de formation du syncytium, nous avons suivi la dynamique de division de la cellule précurseur de la lignée germinale, P4 en deux CGP dans l’embryon de C. elegans. Nous avons démontré que les CGPs commencent la cytocinèse de manière similaire aux cellules somatiques, en formant un sillon de clivage, qui migre correctement et transforme ainsi l'anneau contractile en anneau de « midbody ring » (MBR), une structure qui relie de manière transitoire les cellules en division. Malgré cela, les CGPs, contrairement à leurs homologues somatiques, ne parviennent pas à accomplir la dernière étape de la cytocinèse, qui est la libération abscission-dépendante du MBR. Au lieu de cela, le MBR persiste à la frontière entre les CGPs en division et subit une réorganisation et une maturation pour se transformer finalement en structures en forme d'anneau qui relient les cellules en division. Nous montrons en outre que les composants du MB/MBR; UNC-59Septin, CYK-7, ZEN-4Mklp1, RHO-1RhoA sont localisés à des anneaux de CG au long du développement de la lignée germinale du stade L1 à l'âge adulte, ce qui suggère que les anneaux de CG sont dérivés des MBR. Bien qu'il reste encore beaucoup à faire pour comprendre pleinement le mécanisme précis de la formation du syncytium, le maintien, ainsi que la fonction du syncytium, nos résultats appuient un modèle dans lequel la stabilisation du MBR et la cytocinèse incomplète pourraient être une option conservée dans l’évolution pour la formation du syncytium. En outre, notre travail démontre que les régulateurs de la contractilité peuvent jouer un rôle dans la maturation et l’élasticité de l'anneau de CG au cours du développement de la lignée germinale, fournissant un ajout précieux pour une plus ample compréhension de la syncytiogenèse et de sa fonction.

Systematics and evolution of the genus Deuterocohnia Mez (Bromeliaceae)

The present study investigates the systematics and evolution of the Neotropical genus Deuterocohnia Mez (Bromeliaceae). It provides a comprehensive taxonomic revision as well as phylogenetic analyses based on chloroplast and nuclear DNA sequences and presents a hypothesis on the evolution of the genus. A broad morphological, anatomical, biogeographical and ecological overview of the genus is given in the first part of the study. For morphological character assessment more than 700 herbarium specimens from 39 herbaria as well as living plant material in the field and in the living collections of botanical gardens were carefully examined. The arid habitats, in which the species of Deuterocohnia grow, are reflected by the morphological and anatomical characters of the species. Important characters for species delimitation were identified, like the length of the inflorescence, the branching order, the density of flowers on partial inflorescences, the relation of the length of the primary bracts to that of the partial inflorescence, the sizes of floral bracts, sepals and petals, flower colour, the presence or absence of a pedicel, the curvature of the stamina and the petals during anthesis. After scrutinizing the nomenclatural history of the taxa belonging to Deuterocohnia – including the 1992 syonymized genus Abromeitiella – 17 species, 4 subspecies and 4 varieties are accepted in the present revision. Taxonomic changes were made in the following cases: (I) New combinations: A. abstrusa (A. Cast.) N. Schütz is re-established – as defined by Castellanos (1931) – and transfered to D. abstrusa; D. brevifolia (Griseb.) M.A. Spencer & L.B. Sm. includes accessions of the former D. lorentziana (Mez) M.A. Spencer & L.B. Sm., which are not assigned to D. abstrusa; D. bracteosa W. Till is synonymized to D. strobilifera Mez; D. meziana Kuntze ex Mez var. carmineo-viridiflora Rauh is classified as a subspecies of D. meziana (ssp. carmineo-viridiflora (Rauh) N. Schütz); D. pedicellata W. Till is classified as a subspecies of D. meziana (ssp. pedicellata (W. Till) N. Schütz); D. scapigera (Rauh & L. Hrom.) M.A. Spencer & L.B. Sm ssp. sanctae-crucis R. Vásquez & Ibisch is classified as a species (D. sanctae-crucis (R. Vásquez & Ibisch) N. Schütz); (II) New taxa: a new subspecies of D. meziana Kuntze ex Mez is established; a new variety of D. scapigera is established; (the new taxa will be validly published elsewhere); (III) New type: an epitype for D. longipetala was chosen. All other species were kept according to Spencer and Smith (1992) or – in the case of more recently described species – according to the protologue. Beside the nomenclatural notes and the detailed descriptions, information on distribution, habitat and ecology, etymology and taxonomic delimitation is provided for the genus and for each of its species. An key was constructed for the identification of currently accepted species, subspecies and varieties. The key is based on easily detectable morphological characters. The former synonymization of the genus Abromeitiella into Deuterocohnia (Spencer and Smith 1992) is re-evalutated in the present study. Morphological as well as molecular investigations revealed Deuterocohnia incl. Abromeitiella as being monophyletic, with some indications that a monophyletic Abromeitiella lineage arose from within Deuterocohnia. Thus the union of both genera is confirmed. The second part of the present thesis describes and discusses the molecular phylogenies and networks. Molecular analyses of three chloroplast intergenic spacers (rpl32-trnL, rps16-trnK, trnS-ycf3) were conducted with a sample set of 119 taxa. This set included 103 Deuterocohnia accessions from all 17 described species of the genus and 16 outgroup taxa from the remainder of Pitcairnioideae s.str. (Dyckia (8 sp.), Encholirium (2 sp.), Fosterella (4 sp.) and Pitcairnia (2 sp.)). With its high sampling density, the present investigation by far represents the most comprehensive molecular study of Deuterocohnia up till now. All data sets were analyzed separately as well as in combination, and various optimality criteria for phylogenetic tree construction were applied (Maximum Parsimony, Maximum Likelihood, Bayesian inferences and the distance method Neighbour Joining). Congruent topologies were generally obtained with different algorithms and optimality criteria, but individual clades received different degrees of statistical support in some analyses. The rps16-trnK locus was the most informative among the three spacer regions examined. The results of the chloroplast DNA analyses revealed a highly supported paraphyly of Deuterocohnia. Thus, the cpDNA trees divide the genus into two subclades (A and B), of which Deuterocohnia subclade B is sister to the included Dyckia and Encholirium accessions, and both together are sister to Deuterocohnia subclade A. To further examine the relationship between Deuterocohnia and Dyckia/Encholirium at the generic level, two nuclear low copy markers (PRK exon2-5 and PHYC exon1) were analysed with a reduced taxon set. This set included 22 Deuterocohnia accessions (including members of both cpDNA subclades), 2 Dyckia, 2 Encholirium and 2 Fosterella species. Phylogenetic trees were constructed as described above, and for comparison the same reduced taxon set was also analysed at the three cpDNA data loci. In contrast to the cpDNA results, the nuclear DNA data strongly supported the monophyly of Deuterocohnia, which takes a sister position to a clade of Dyckia and Encholirium samples. As morphology as well as nuclear DNA data generated in the present study and in a former AFLP analysis (Horres 2003) all corroborate the monophyly of Deuterocohnia, the apparent paraphyly displayed in cpDNA analyses is interpreted to be the consequence of a chloroplast capture event. This involves the introgression of the chloroplast genome from the common ancestor of the Dyckia/ Encholirium lineage into the ancestor of Deuterocohnia subclade B species. The chloroplast haplotypes are not species-specific in Deuterocohnia. Thus, one haplotype was sometimes shared by several species, where the same species may harbour different haplotypes. The arrangement of haplotypes followed geographical patterns rather than taxonomic boundaries, which may indicate some residual gene flow among populations from different Deuteroccohnia species. Phenotypic species coherence on the background of ongoing gene flow may then be maintained by sets of co-adapted alleles, as was suggested by the porous genome concept (Wu 2001, Palma-Silva et al. 2011). The results of the present study suggest the following scenario for the evolution of Deuterocohnia and its species. Deuterocohnia longipetala may be envisaged as a representative of the ancestral state within the genus. This is supported by (1) the wide distribution of this species; (2) the overlap in distribution area with species of Dyckia; (3) the laxly flowered inflorescences, which are also typical for Dyckia; (4) the yellow petals with a greenish tip, present in most other Deuterocohnia species. The following six extant lineages within Deuterocohnia might have independently been derived from this ancestral state with a few changes each: (I) D. meziana, D. brevispicata and D. seramisiana (Bolivia, lowland to montane areas, mostly reddish-greenish coloured, very laxly to very densely flowered); (II) D. strobilifera (Bolivia, high Andean mountains, yellow flowers, densely flowered); (III) D. glandulosa (Bolivia, montane areas, yellow-greenish flowers, densely flowered); (IV) D. haumanii, D. schreiteri, D. digitata, and D. chrysantha (Argentina, Chile, E Andean mountains and Atacama desert, yellow-greenish flowers, densely flowered); (V) D. recurvipetala (Argentina, foothills of the Andes, recurved yellow flowers, laxly flowered); (VI) D. gableana, D. scapigera, D. sanctae-crucis, D. abstrusa, D. brevifolia, D. lotteae (former Abromeitiella species, Bolivia, Argentina, higher Andean mountains, greenish-yellow flowers, inflorescence usually simple). Originating from the lower montane Andean regions, at least four lineages of the genus (I, II, IV, VI) adapted in part to higher altitudes by developing densely flowered partial inflorescences, shorter flowers and – in at least three lineages (II, IV, VI) – smaller rosettes, whereas species spreading into the lowlands (I, V) developed larger plants, laxly flowered, amply branched inflorescences and in part larger flowers (I).

Sufficiency of Favard's condition for a class of band-dominated operators on the axis

The purpose of this paper is to show that, for a large class of band-dominated operators on $\ell^\infty(Z,U)$, with $U$ being a complex Banach space, the injectivity of all limit operators of $A$ already implies their invertibility and the uniform boundedness of their inverses. The latter property is known to be equivalent to the invertibility at infinity of $A$, which, on the other hand, is often equivalent to the Fredholmness of $A$. As a consequence, for operators $A$ in the Wiener algebra, we can characterize the essential spectrum of $A$ on $\ell^p(Z,U)$, regardless of $p\in[1,\infty]$, as the union of point spectra of its limit operators considered as acting on $\ell^p(Z,U)$.

A dendrochemical study of Pinus sylvestris from Siljansfors Experimental Forest, central Sweden

Inductively coupled plasma mass spectrometry (ICP-MS) was used to investigate changes in trace element concentration in two high resolution sequences of tree rings from central Sweden. Individual annual growth increments from 18002002 to 1930-2002 were sampled from two Scots pine (Pinus sylvestris) trees from the Siljansfors Experimental Forest. The aims of the study were: to test the viability of conventional solution induction ICP-MS as a technique for investigating the multi-elemental chemistry of long tree ring sequences at annual resolution, and, to test this specifically with a view to detecting changes in elemental concentrations of Swedish tree rings contemporary with the major (and relatively proximal) Icelandic eruption of Askja (1875). It was found that despite a time consuming sample preparation process, it was possible to use conventional ICP-MS for multi-elemental analysis of a long sequence of tree rings at annual resolution. Although promising data were produced, no truly conclusive concentration anomaly could be detected in the sequence to indicate the impact of the Askja eruption on environmental chemistry. Overall findings underlined the complexity of the tree/environment interaction and the cautious approach to data interpretation essential for any dendrochemical study. (c) 2006 Elsevier Ltd. All rights reserved.

Amount of substance and the Mole

The International System of Units, the SI, is built upon seven base quantities and seven base units, as summarized in the table below. Although most of these are familiar to all scientists, the quantity “amount of substance” and its unit “mole” are less familiar and are mainly used by chemists.1 In the chemistry community, the unit “mole” is familiar, but the name of the corresponding quantity “amount of substance” is not so familiar, and the concept is still a source of difficulty for many students. This article reviews and clarifies these two concepts2 and discusses the definition of the unit “mole” and its possible revision.

Evolution of functional diversity in the cupin superfamily

The cupin superfamily of proteins is among the most functionally diverse of any described to date. It was named on the basis of the conserved beta-barrel fold ('cupa' is the Latin term for a small barrel), and comprises both enzymatic and non-enzymatic members, which have either one or two cupin domains. Within the conserved tertiary structure, the variety of biochemical function is provided by minor variation of the residues in the active site and the identity of the bound metal ion. This review discusses the advantages of this particular scaffold and provides an evolutionary analysis of 18 different subclasses within the cupin superfamily.

Low-temperature determination of theophylline dimethyl sulfoxide solvate

The title solvate, C7H8N4O2 center dot C2H6OS, was obtained unintentionally from a cocrystal screen involving theophylline and isophthalic acid. One molecule each of theophylline and dimethyl sulfoxide is present in the asymmetric unit. The packing consists of molecular sheets lying parallel to the ( 040) series of lattice planes, in which each theophylline molecule is hydrogen bonded to one dimethyl sulfoxide molecule through an N-H center dot center dot center dot O [2.7658 (15) angstrom] hydrogen bond. This particular hydrogen-bond donor was found to be used in this type of interaction in a variety of other crystal structures of theophylline.

Use of thermography and fibre optics microscopy for the evaluation of railway structures in the Athens Metro in Greece (Invited Paper)

Rolling Contact Fatigue (RCF) is one of the main issues that concern, at least initially, the head of the railway; progressively they can be of very high importance as they can propagate inside the material with the risk of damaging the railway. In this work, two different non-destructive techniques, infrared thermography (IRT) and fibre optics microscopy (FOM), were used in the inspection of railways for the tracing of defects and deterioration signs. In the first instance, two different approaches (dynamic and pulsed thermography) were used, whilst in the case of FOM, microscopic characterisation of the railway heads and classification of the deterioration -- damage on the railways according to the UIC (International Union of Railways) code, took place. Results from both techniques are presented and discussed.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Actinomyces coleocanis sp. nov., from the vagina of a dog

A hitherto undescribed Actinomyces-like bacterium was isolated from the vagina of a dog. Biochemical testing and PAGE analysis of whole-cell proteins indicated that the isolate was phenotypically different from previously described Actinomyces species and related taxa. Sequencing of 165 rRNA showed that the unknown bacterium was distinct from all currently known Actinomyces species. Phylogenetically, the unidentified organism displayed a specific association with Actinomyces europaeus, but a sequence divergence of > 5% demonstrated that it represents a distinct species. Based on both phenotypic and 165 rRNA sequence considerations, it is proposed that the unknown strain from a dog be classified as a novel species, Actinomyces coleocanis sp. nov. The type strain is CCUG 41708T (= CIP 106873T).

Arcanobacterium hippocoleae sp. nov., from the vagina of a horse

A polyphasic taxonomic study was performed on a previously unidentified gram-positive, facultatively anaerobic, diphtheroid-shaped organism isolated from a vaginal discharge of a horse. Comparative 16S rRNA gene sequencing demonstrated that the strain was a member of the genus Arcanobacterium, but sequence divergence values of >4% with described species of this genus (viz: Arcanobacterium haemolyticum, Arcanobacterium bernardiae, Arcanobacterium phocae, Arcanobacterium pluranimalium and Arcanobacterium pyogenes) demonstrated that the isolate represented a novel species. The unknown bacterium was readily distinguished from other Arcanobacterium species by biochemical tests. Based on phylogenetic and phenotypic evidence, it is proposed that the unknown bacterium be classified as Arcanobacterium hippocoleae sp. nov. The type strain of A. hippocoleae is CCUG 44697T (= CIP 106850T).

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Redefining the outer boundaries of EU Law: the Zambrano, McCarthy and Dereci trilogy

In its three recent rulings in the cases of Zambrano, McCarthy, and Dereci, the Court appears to have been determined to redefine the external boundaries of EU law, in cases involving the family reunification rights of Union citizens.These three judgments can be read as an indication that for Article 20 TFEU to apply, there is no longer a requirement of a cross-border element on the facts of the case, and that it is sufficient if the contested national measure has the effect of ‘depriving citizens of the Union of the genuine enjoyment of the substance’ of their rights (the ‘Zambrano principle’).The cases can, at the same time, also be read as a confirmation that the free movement provisions do – still – require a cross-border element and, in particular, the exercise of inter-State movement, in order to apply. Though the result in these cases has not been entirely unexpected, especially in the aftermath of the Rottmann ruling, it is rather problematic in that, although it is obvious that the Court wishes to redraw the line dividing the national and EU spheres of competence, it does not make it entirely clear where this line now lies and leaves many essential questions unanswered, which will obviously require some time to be resolved. EU lawyers are consequently, once more, left with having to decipher as best as they can the real intentions of the Court in this new line of case-law, which has been further complicated by the fact that what the Court seems to have given with one hand in Zambrano (and before that in Rottmann), has taken it back to a large extent through its rulings in McCarthy and Dereci, which appear to confine the former two cases to their own exceptional facts.6 Moreover, the ‘reverse discrimination Pandora’s box’, the opening of which appears to have been the real target of these references, remains untouched: instead of providing a direct solution to this problem, the Court has chosen to – once again – broaden the scope of the Treaty provisions in order to include within it as many situations as possible and, thus, prevent the emergence of this type of differential treatment on a case-by-case basis.As will be explained, nonetheless, this is by no means an appropriate solution to the reverse discrimination conundrum.

Eliminating the small-angle component of the scattering calculated for models

A straightforward procedure (assuming spherical symmetry) is described, which enables the unwanted small-angle component of the scattering for a finite model to be calculated. The method may be applied to models of any shape or size. It is illustrated by means of a single polymer chain.