Effect of chronic fish oil supplementation on renal function of normal and cachectic rats

In the present study we determined the effect of chronic diet supplementation with n-3 PUFA on renal function of healthy and cachectic subjects by providing fish oil (1 g/kg body weight) to female rats throughout pregnancy and lactation and then to their offspring post-weaning and examined its effect on renal function parameters during their adulthood. The animals were divided into four groups of 5-10 rats in each group: control, control supplemented with fish oil (P), cachectic Walker 256 tumor-bearing (W), and W supplemented with fish oil (WP). Food intake was significantly lower in the W group compared to control (12.66 ± 4.24 vs 25.30 ± 1.07 g/day). Treatment with fish oil significantly reversed this reduction (22.70 ± 2.94 g/day). Tumor growth rate was markedly reduced in the P group (16.41 ± 2.09 for WP vs 24.06 ± 2.64 g for W). WP group showed a significant increase in mean glomerular filtration rate compared to P and control (1.520 ± 0.214 ml min-1 kg body weight-1; P < 0.05). Tumor-bearing groups had low urine osmolality compared to control rats. The fractional sodium excretion decreased in the W group compared to control (0.43 ± 0.16 vs 2.99 ± 0.87%; P < 0.05), and partially recovered in the WP group (0.90 ± 0.20%). In summary, the chronic supplementation with fish oil used in this study increased the amount of fat in the diet by only 0.1%, but caused remarkable changes in tumor growth rate and cachexia, also showing a renoprotective function.

Acetylcholine and bradykinin enhance hypotension and affect the function of remodeled conduit arteries in SHR and SHR treated with nitric oxide donors

Discrepancy was found between enhanced hypotension and attenuated relaxation of conduit arteries in response to acetylcholine (ACh) and bradykinin (BK) in nitric oxide (NO)-deficient hypertension. The question is whether a similar phenomenon occurs in spontaneously hypertensive rats (SHR) with a different pathogenesis. Wistar rats, SHR, and SHR treated with NO donors [molsidomine (50 mg/kg) or pentaerythritol tetranitrate (100 mg/kg), twice a day, by gavage] were studied. After 6 weeks of treatment systolic blood pressure (BP) was increased significantly in experimental groups. Under anesthesia, the carotid artery was cannulated for BP recording and the jugular vein for drug administration. The iliac artery was used for in vitro studies and determination of geometry. Compared to control, SHR showed a significantly enhanced (P < 0.01) hypotensive response to ACh (1 and 10 µg, 87.9 ± 6.9 and 108.1 ± 5.1 vs 35.9 ± 4.7 and 64.0 ± 3.3 mmHg), and BK (100 µg, 106.7 ± 8.3 vs 53.3 ± 5.2 mmHg). SHR receiving NO donors yielded similar results. In contrast, maximum relaxation of the iliac artery in response to ACh was attenuated in SHR (12.1 ± 3.6 vs 74.2 ± 8.6% in controls, P < 0.01). Iliac artery inner diameter also increased (680 ± 46 vs 828 ± 28 µm in controls, P < 0.01). Wall thickness, wall cross-section area, wall thickness/inner diameter ratio increased significantly (P < 0.01). No differences were found in this respect among SHR and SHR treated with NO donors. These findings demonstrated enhanced hypotension and attenuated relaxation of the conduit artery in response to NO activators in SHR and in SHR treated with NO donors, a response similar to that found in NO-deficient hypertension.

Regulation and function of neurogenesis in the adult vertebrate brain

Most adult tissues retain a reservoir of self-renewing, multipotent stem cells that can generate differentiated tissue components. Until recently, the brain was thought to be an exception to this rule and for many years the pervasive dogma of neurobiology relegated neurogenesis to the embryonic and earlier postnatal stages of development. The discovery of constant neuronal replacement in the adult brain has changed the way we think about neurological diseases and about the exploration of new strategies for brain repair. In this review we will explore the potential of adult neural stem cells and we will present some of our own work on this subject. We will also discuss the possibility that adult neurogenesis and neuronal replacement may also play a role in therapies aimed at restoring impaired brain function. A better understanding of the various aspects of spontaneous neuronal replacement may also be used to increase the success of procedures with cell therapies.

Computerized invasive measurement of time-dependent intraocular pressure

Several methods have been described to measure intraocular pressure (IOP) in clinical and research situations. However, the measurement of time varying IOP with high accuracy, mainly in situations that alter corneal properties, has not been reported until now. The present report describes a computerized system capable of recording the transitory variability of IOP, which is sufficiently sensitive to reliably measure ocular pulse peak-to-peak values. We also describe its characteristics and discuss its applicability to research and clinical studies. The device consists of a pressure transducer, a signal conditioning unit and an analog-to-digital converter coupled to a video acquisition board. A modified Cairns trabeculectomy was performed in 9 Oryctolagus cuniculus rabbits to obtain changes in IOP decay parameters and to evaluate the utility and sensitivity of the recording system. The device was effective for the study of kinetic parameters of IOP, such as decay pattern and ocular pulse waves due to cardiac and respiratory cycle rhythm. In addition, there was a significant increase of IOP versus time curve derivative when pre- and post-trabeculectomy recordings were compared. The present procedure excludes corneal thickness and error related to individual operator ability. Clinical complications due to saline infusion and pressure overload were not observed during biomicroscopic evaluation. Among the disadvantages of the procedure are the requirement of anesthesia and the use in acute recordings rather than chronic protocols. Finally, the method described may provide a reliable alternative for the study of ocular pressure dynamic alterations in man and may facilitate the investigation of the pathogenesis of glaucoma.

Effect of metabolic syndrome and of its individual components on renal function of patients with type 2 diabetes mellitus

The objective of this study was to evaluate the effect of metabolic syndrome (MetS) and its individual components on the renal function of patients with type 2 diabetes mellitus (DM). A cross-sectional study was performed in 842 type 2 DM patients. A clinical and laboratory evaluation, including estimated glomerular filtration rate (eGFR) calculated by the modification of diet in renal disease formula, was performed. MetS was defined according to National Cholesterol Education Program - Adult Treatment Panel III criteria. Mean patient age was 57.9 ± 10.1 years and 313 (37.2%) patients were males. MetS was detected in 662 (78.6%) patients. A progressive reduction in eGFR was observed as the number of individual MetS components increased (one: 98.2 ± 30.8; two: 92.9 ± 28.1; three: 84.0 ± 25.1; four: 83.8 ± 28.5, and five: 79.0 ± 23.0; P < 0.001). MetS increased the risk for low eGFR (<60 mL·min-1·1.73 (m²)-1) 2.82-fold (95%CI = 1.55-5.12, P < 0.001). Hypertension (OR = 2.2, 95%CI = 1.39-3.49, P = 0.001) and hypertriglyceridemia (OR = 1.62, 95%CI = 1.19-2.20, P = 0.002) were the individual components with the strongest associations with low eGFR. In conclusion, there is an association between MetS and the reduction of eGFR in patients with type 2 DM, with hypertension and hypertriglyceridemia being the most important contributors in this sample. Interventional studies should be conducted to determine if treatment of MetS can prevent renal failure in type 2 DM patients.

Antipyretic and antioxidant activities of 5-trifluoromethyl-4,5-dihydro-1H-pyrazoles in rats

The objective of this study was to determine the effect of eight 5-hydroxy-5-trifluoromethyl-4,5-dihydro-1H-1-carboxyamidepyrazoles (TFDPs) on rat body temperature and baker’s yeast-induced fever. TFDPs or vehicle (5% Tween 80 in 0.9% NaCl, 5 mL/kg) were injected subcutaneously and rectal temperature was measured as a function of time in 28-day-old male Wistar rats (N = 5-12 per group). Antipyretic activity was determined in feverish animals injected with baker’s yeast (Saccharomyces cerevisiae suspension, 0.135 mg/kg, 10 mL/kg, ip). 3-Ethyl- and 3-propyl-TFDP (140 and 200 μmol/kg, respectively, 4 h after yeast injection) attenuated baker’s yeast-induced fever by 61 and 82%, respectively. These two effective antipyretics were selected for subsequent analysis of putative mechanisms of action. We then determined the effects on cyclooxygenase-1 and -2 (COX-1 and COX-2) activities on 1,1-diphenyl-2-picrylhydrazyl (DPPH) oxidation in vitro, on tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) levels and on leukocyte counts in the washes of peritoneal cavities of rats injected with baker’s yeast. While 3-ethyl- and 3-propyl-TFDP did not reduce baker’s yeast-induced increases of IL-1β or TNF-α levels, 3-ethyl-TFDP caused a 42% reduction in peritoneal leukocyte count. 3-Ethyl- and 3-propyl-TFDP did not alter COX-1 or COX-2 activities in vitro, but presented antioxidant activity in the DPPH assay with an IC50 of 39 mM (25-62) and 163 mM (136-196), respectively. The data indicate that mechanisms of action of these two novel antipyretic pyrazole derivatives do not involve the classic inhibition of the COX pathway or pyrogenic cytokine release.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Diabetes mellitus affects the biomechanical function of the callus and the expression of TGF-beta1 and BMP2 in an early stage of fracture healing

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Effect of hyperbaric oxygenation on mitochondrial function of neuronal cells in the cortex of neonatal rats after hypoxic-ischemic brain damage

The timing and mechanisms of protection by hyperbaric oxygenation (HBO) in hypoxic-ischemic brain damage (HIBD) have only been partially elucidated. We monitored the effect of HBO on the mitochondrial function of neuronal cells in the cerebral cortex of neonatal rats after HIBD. Neonatal Sprague-Dawley rats (total of 360 of both genders) were randomly divided into normal control, HIBD, and HIBD+HBO groups. The HBO treatment began immediately after hypoxia-ischemia (HI) and continued once a day for 7 consecutive days. Animals were euthanized 0, 2, 4, 6, and 12 h post-HI to monitor the changes in mitochondrial membrane potential (ΔΨm) occurring soon after a single dose of HBO treatment, as well as 2, 3, 4, 5, 6, and 7 days post-HI to study ΔΨm changes after a series of HBO treatments. Fluctuations in ΔΨm were observed in the ipsilateral cortex in both HIBD and HIBD+HBO groups. Within 2 to 12 h after HI insult, the ΔΨm of the HIBD and HIBD+HBO groups recovered to some extent. A secondary drop in ΔΨm was observed in both groups during the 1-4 days post-HI period, but was more severe in the HIBD+HBO group. There was a secondary recovery of ΔΨm observed in the HIBD+HBO group, but not in the HIBD group, during the 5-7 days period after HI insult. HBO therapy may not lead to improvement of neural cell mitochondrial function in the cerebral cortex in the early stage post-HI, but may improve it in the sub-acute stage post-HI.

Microstructural changes of frozen strawberries submitted to pre-treatments with additives and vacuum impregnation

Strawberries were submitted to freezing after pre-treatments with hydrocolloid and calcium salts (pectin and calcium chloride) at different concentrations, in the attempt to establish a correlation of the effects of these substances and their processing, on the physical and microstructural characteristics of fruits after thawing. Strawberry halves were submitted to impregnation with controlled vacuum pressure of 84.4, 50.5 and 16.6 kPa; comprising pectin at concentrations of 0, 1.5 and 3%; with the addition of calcium chloride at concentrations of 0, 3 and 6%; and glucose at 20%, for 4 hours. Measurements were made of the total soluble solid contents, cellular fluid loss, texture and viscosity of the solution, before and after the freezing/thawing. Images of the tissue cuts during the freezing, in function of time, were taken in an optic microscope coupled to a cold-stage and controlled temperature system, where the reduction of the cellular area was quantified using an image analyzing software. The pectin concentration had an influence on and demonstrated a potential for protection of the frozen tissue samples. The photomicrographs showed that the loss of cellular fluid occurs during the growth of ice formed in the intercellular spaces and it is retarded through treatments with high pectin concentrations.

Mathematical modeling of dehydration of 'Fuji' and 'Gala' apples slices using infrared

The objective of this work was to determine and model the infrared dehydration curves of apple slices - Fuji and Gala varieties. The slices were dehydrated until constant mass, in a prototype dryer with infrared heating source. The applied temperatures ranged from 50 to 100 °C. Due to the physical characteristics of the product, the dehydration curve was divided in two periods, constant and falling, separated by the critical moisture content. A linear model was used to describe the constant dehydration period. Empirical models traditionally used to model the drying behavior of agricultural products were fitted to the experimental data of the falling dehydration period. Critical moisture contents of 2.811 and 3.103 kgw kgs-1 were observed for the Fuji and Gala varieties, respectively. Based on the results, it was concluded that the constant dehydration rates presented a direct relationship with the temperature; thus, it was possible to fit a model that describes the moisture content variation in function of time and temperature. Among the tested models, which describe the falling dehydration period, the model proposed by Midilli presented the best fit for all studied conditions.

Chemical, biochemical, and microbiological aspects of chitosan quaternary salt as active coating on sliced apples

The biocompatibility of chitosan and chitosan quaternary salt coatings was evaluated for use as edible coatings for sliced apple. Measurement of water loss, color change, and fungal growth appearance were monitored as a function of time. A significant brownish effect was observed on chitosan coated slices, varying greatly from L* = 76.5 and Hue angle = 95.9° (t = 0) to L* = 45.3 and Hue angle = 69.8° (t = 3 days), whilst for TMC coated samples the variation was considerable lower (L* = 74.1; Hue angle = 95.0°) to (L* = 67.0; Hue angle = 83.8°) within the same period. The hydrosoluble derivative N,N,N-trimethylchitosan demonstrated good antifungal activity against P. expansum although highly dependent on the polymer properties such as degree of quaternization. The most efficient formulation was that prepared from derivative having a degree of quaternization of 45%, high solubility, and high viscosity. This formulation restrained fungus spreading up to 30%, while for the control it reached almost 80% of the total assessed surfaces during 7 days of storage.

Thermophysical and rheological properties of dulce de leche with and without coconut flakes as a function of temperature

Dulce de leche (DL), a dairy dessert highly appreciated in Brazil, is a concentrated product containing about 70% m/m of total solids. Thermophysical and rheological properties of two industrial Brazilian Dulce de leche formulations (classic Dulce de leche and Dulce de leche added with coconut flakes 1.5% m/m) were determined at temperatures comprised between 28.4 and 76.4 °C. In general, no significant differences (p < 0.05) were observed in the presence of coconut flakes in the two formulations. Heat capacity varied from 2633.2 to 3101.8 J/kg.°C; thermal conductivity from 0.383 to 0.452 W/m.°C; specific mass from 1350.7 to 1310.7 kg/m³; and, thermal diffusivity from (1.082 × 10-7 to 1.130 × 10-7) m²/s. The Bingham model was used to properly describe the non-Newtonian behavior of both formulations, with yielding stress values varying from 27.3 to 17.6 Pa and plastic viscosity from 19.9 to 5.9 Pa.s.