Uma fonte chaveada de 50kW com correção de fator de potência para alimentação de uma tocha de plasma Indutiva utilizando técnicas de controle digital

This work deals with the development of an experimental study on a power supply of high frequency that provides the toch plasmica to be implemented in PLASPETRO project, which consists of two static converters developed by using Insulated Gate Bipolar Transistor (IGBT). The drivers used to control these keys are triggered by Digital Signal Processor (DSP) through optical fibers to reduce problems with electromagnetic interference (EMI). The first stage consists of a pre-regulator in the form of an AC to DC converter with three-phase boost power factor correction which is the main theme of this work, while the second is the source of high frequency itself. A series-resonant inverter consists of four (4) cell inverters operating in a frequency around 115 kHz each one in soft switching mode, alternating itself to supply the load (plasma torch) an alternating current with a frequency of 450 kHz. The first stage has the function of providing the series-resonant inverter a DC voltage, with the value controlled from the power supply provided by the electrical system of the utility, and correct the power factor of the system as a whole. This level of DC bus voltage at the output of the first stage will be used to control the power transferred by the inverter to the load, and it may vary from 550 VDC to a maximum of 800 VDC. To control the voltage level of DC bus driver used a proportional integral (PI) controller and to achieve the unity power factor it was used two other proportional integral currents controllers. Computational simulations were performed to assist in sizing and forecasting performance. All the control and communications needed to stage supervisory were implemented on a DSP

Projeto em FPGA de um controlador unificado para correção de fator de potência em retificadores boost bidirecionais monofásicos

The use of Field Programmable Gate Array (FPGA) for development of digital control strategies for power electronics applications has aroused a growing interest of many researchers. This interest is due to the great advantages offered by FPGA, which include: lower design effort, high performance and highly flexible prototyping. This work proposes the development and implementation of an unified one-cycle controller for boost CFP rectifier based on FPGA. This controller can be applied to a total of twelve converters, six inverters and six rectifiers defined by four single phase VSI topologies and three voltage modulation types. The topologies considered in this work are: full-bridge, interleaved full-bridge, half-bridge and interleaved half-bridge. While modulations are classified in bipolar voltage modulation (BVM), unipolar voltage modulation (UVM) and clamped voltage modulation (CVM). The proposed project is developed and prototyped using tools Matlab/Simulink® together with the DSP Builder library provided by Altera®. The proposed controller was validated with simulation and experimental results

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Escala de atitudes frente ao HIV/AIDS: análise de fatores

OBJETIVO: Este trabalho apresenta resultados acerca das propriedades psicométricas da Escala de atitudes frente ao HIV/AIDS. Os dados, provenientes de uma amostra de 549 alunos entre universitários, ensinos médio e ensino fundamental. MÉTODOS: Os dados foram tratados pelo método dos componentes principais da análise fatorial. A análise final, postulado um eigenvalue mínimo de 2, resultou cinco fatores. Foram eliminados itens que apresentaram carga fatorial menor que 0,30. Neste estudo, o menor alfa observado foi de 0,79. Portanto, é provável que todos os 47 itens do instrumento final elaborado meçam o mesmo construto: atitude frente ao HIV/AIDS. RESULTADOS: Escores inferiores a 96 foram considerados fraco grau de conhecimento sobre HIV/AIDS; entre 96 e 192 moderado grau de conhecimento e acima de 192 alto grau de conhecimento sobre HIV/AIDS. Foram estabelecidos os fatores: 1, 2 e 3, sendo fator geral de percepção da informação técnico-científica; fator de percepção da informação técnico-científica versus sexualidade e preconceito; fator de percepção da informação técnico-científica no uso de drogas, respectivamente. CONCLUSÕES: O alfa de Cronbach encontrado para a escala como um todo foi de 0,859, sugerindo fortemente a existência da fidedignidade do instrumento que se mostrou útil para avaliar o grau de conhecimento acerca do HIV/AIDS e o risco decorrente do desconhecimento, entre estudantes.

Comportamento elétrico a alta temperatura de termistor cerâmico alfa-Fe2O3 com coeficiente de temperatura negativo

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

O jogo das identidades como fator de mobilização político-eleitoral nas campanhas de Dilma Rousseff e Rosalba Ciarlini em 2010

Starting from the premise that we live in the society of spectacle, as proclaimed by Guy Debbord, and, in this context, the media feeds itself off of this spectacularization and constructs a culture of images and production of goods, providing templates from which the subject can identify himself/herself as being male or female, successful or unsuccessful, powerful or powerless. In other words, the culture conveyed by the media produces material for the creation of identities through which individuals insert and recognize themselves in contemporary society. Observing the election campaigns, we can see clearly that this profusion of identities is fairly explored in the advertising propaganda used by the candidates, particularly in the propaganda broadcasted on the Free Electoral Time on TV. Instigated by the explicit relation between the media and politics within the society of the spectacle, this study aims to investigate the main identities that emerge in the discursive practices of the media in the election campaigns of 2010 for president of the Republic and governor of the State of Rio Grande do Norte that had as protagonists the candidates at that moment Dilma Rousseff (PT) for president and Rosalba Ciarline (DEM) for governor. To do so, we based ourselves on the theory of Bakhtin Circle, which considers the statement as a unit of verbal communication and conceives language as a dialogical phenomena and a discursive practice and also in the conceptions of dialogical relationships, social voices and chronotope formulated by the previous mentioned theory. Still in the theoretical field, we have established an interconnection with the theories coming from the Cultural Studies (Hall, Woodward) about the identity, which conceives it as multiple, fragmented, non-fixed, so that, the subject assumes different identities, not always coherent, at different times, depending on the context in which they are approached. The research is situated in the frames of Applied Linguistics, which considers language as the center of its studies and settles on the border of an open number of areas of knowledge expanding its possibilities of investigation by means of the interdisciplinary. Our corpus consists in 20 electoral propaganda videos aired on TV during the Free Election Time in 2010 campaign; among these, 14 videos are Dilma Rousseff s propaganda and 06 videos are Rosalba Ciarline s propaganda. We seek for the purpose of the analysis to identify the identities which emerge from the discourses about the candidates in propaganda videos broadcasted in the referred campaign, as well as realize the dialogical relations established in these discourses and even if the identity construction of these subjects is located in the same axiological axis. The corpus analysis revealed that the multiple cultural identities of the candidates campaigning emerge in the discourses circulating in the electoral propaganda aired on TV such as: the identities of pioneer woman, competent, sensitive, mother, grandmother, religious. And, yet, those are changeable as the electoral demands, in other words, the need to obtain support and votes, outline a fluid identity construction about the candidate to the position in question

A diversidade de interpretações como fator constituinte da formação docente: leitura e observação

Neste artigo apresentamos a análise de interpretações de estudantes em trabalhos desenvolvidos em duas disciplinas de cursos de Licenciatura em Física, nas quais realizamos atividades bastante distintas, uma envolvendo a leitura e outra a observação pelos licenciandos. Buscamos compreender falas escritas pelos estudantes como parte dessas atividades, e procuramos evidenciar a diversidade de interpretações e a relevância desse trabalho para a formação inicial. O apoio teórico em que nos sustentamos foi a análise de discurso na vertente originada na França por Michel Pêcheux. A consideração da não transparência da linguagem, e as noções de condições de produção, memória discursiva e repetição, bem como alguns aportes sobre possíveis papéis da observação na construção científica, contribuíram para a compreensão de discursos escritos pelos estudantes. Mostramos a diversidade de interpretações dos licenciados: ao opinarem sobre a possibilidade ou não de se trabalhar a física moderna e contemporânea no ensino médio, depois de lerem um texto envolvendo esse tema, e ao redigirem um texto sobre a observação na pesquisa científica.

Valor prognóstico de células TCD8+ E natural killer em carcinoma epidermóide oral e orofaringeano tratado com radioterapia e quimioterapia

The most common malignant neoplasm of the oral cavity and oropharynx are squamous cell carcinoma. Injuries to the same stage and subjected to the same treatment protocol have sometimes different evolutionary courses. The scope of this study was to investigate, through a retrospective cohort, associations between the number of CD8 + T cells and natural killer, identified immunohistochemically in the inflammatory infiltrate in a series of cases of oral squamous cell carcinoma and orofaringeano, and the level of tumor response to radiotherapy and chemotherapy, overall survival and relapse-free survival of patients. We identified 54 patients with unresectable disease were treated exclusively with radiotherapy and chemotherapy. The median follow-up was 22 months. The sample was characterized by the predominance of male subjects, median age 60 years, all were smokers. The most frequent site was the tongue and 81.5% were in stage IV. Patients with disease in the oral cavity had a worse response to treatment (p = 0.006), worse relapse-free survival (p = 0.007), worse overall survival (p = 0.007). The advanced T stage was shown a negative prognostic factor (p= 0.006) for the clinical treatment response made. Immunohistochemistry was performed to select CD8 + cells (anti-CD8) and NK cells (anti-CD57). Lymphocytes positive and negative markings were counted using the program ImageJ ®. Two groups were created for each marking evaluated: Group I patients with more than 50% cells positive, Group II: less than 50% of labeled cells. For CD8 + cells detected in 38 (70.3%) of Group I were CD8 + and 16 (29.7%) Group II CD8 +. For NK cells, 26 (48.15%) Group I NK and 28 (51.85%) Group II NK. Regarding the clinical response to treatment, we observed that 39% of patients achieved a complete response and 25.9% remained without recurrence at the end of follow-up. These results were better in Group I CD8 + (p = 0.2). Identified that 72.2% of patients progressed to death, this finding had no association with the immunohistochemical data. There was no statistically significant differences between the number of CD8 + and NK cells and the ability of tumor response to radiotherapy and chemotherapy, or with overall survival and relapse-free survival of patients. However, especially in relation to a learned response, we found that this group of patients with advanced disease have a low count of CD8 + T cells active. Believing in the role that the immune response plays in the local fight against neoplastic cells, however, our results do not support the use of quantitative analysis of CD8 + T cells and NK cells as a prognostic factors for oral squamous cell carcinoma and oropharynx

Estudo da expressão imuno-histoquímica das proteínas MMP-9, MMP-13 e TIMP-1 em ameloblastomas e tumores odontogênicos ceratocistos

Ameloblastomas and keratocystic odontogenic tumors (KOT) represent odontogenic lesions that, despite their benign nature, are distinguished by a distinct biological behavior, characterized by locally aggressive growth and recurrent episodes. The gnathic bone resorption caused by the growth of these lesions is a key to the expansion of the same, both being mediated by osteoclastic cells like enzymatic activity of various matrix metalloproteinases (MMPs) factor. The expression of stimulatory factors and inhibitors of bone resorption has been correlated with the development of these lesions, with emphasis to some MMPs such as collagenases and gelatinases and tissue inhibitors of metalloproteinases (TIMPs), among others. Based on the premise that stimulatory and inhibitory factors of osteolytic processes can be decisive for the growth rate of intraosseous odontogenic lesions, this experiment evaluated the immunoreactivity of MMP-9, -13 and TIMP-1 protein in the epithelium and mesenchyme of ameloblastoma and the KOT specimens, by a quantitative analysis of the immunoreactivity cells. Statistical analysis was performed using the Mann-Whitney and Wilcoxon tests with a significance level set at 5 %. Immunohistochemical expression of MMP-9, -13 and TIMP-1 was observed in 100% of cases both in the epithelium and in mesenchyme. The immunoreactivity in the epithelium of KOT and ameloblastomas revealed a predominance of score 3 for MMP-9 (p=0.382) and MMP-13 (p=0.069) and no statistically significance for TIMP-1, the latter being significantly higher immunoreactivity in ameloblastomas. In the mesenchyme, there was a higher score immunoreactivity of MMP-13 (p=0.031) in ameloblastomas in relation to KOT, whereas for MMP-9 and TIMP-1 no statistically significant difference (p=0.403 was observed, p=1.000). The calculation of the ratio of scores revealed expression of proteins in general, similarity of the lesions, a significant predominance of equal expression of TIMP-1 and MMP-9 was observed only in the epithelium of ameloblastoma. The marked immunostaining of MMP-9 , MMP-13 and TIMP-1 in epithelium and mesenchyme of the lesion indicate that these proteins involved in ECM remodeling required for tumor progression, however, specific differences in the expression of some of these proteins, are not sufficient to suggest differences in the biological behavior of ameloblastomas and KOTs

Imunoexpressão de vegf-c, vegfr-3 e hif-1α e mensuração da densidade linfática em carcinomas epidermóides de lábio inferior metastáticos e não-metastáticos: uma relação com parâmetros clinicopatológicos e prognósticos

Squamous cell carcinoma of the lower lip is among the most common malignant tumors of the oral and maxillofacial region, with good prognosis in more than 90% of patients with 5-year survival. In these carcinomas, the development of lymph node metastasis decreases the prognosis and it has been associated with the formation of new lymphatic vessels. It has been suggested the important role of vascular endothelial growth factor-C (VEGF-C), the receptor type 3 VEGF (VEGFR-3) and hypoxia-induced factor 1 (HIF-1) in this process. The aim of this study was to evaluate the immunoexpression of VEGF-C, VEGFR-3 and HIF-1α and correlate with intra and peritumoral lymphatic density in squamous cell carcinomas of the lower lip metastatic and non-metastatic. The sample consisted of 50 cases of squamous cell carcinoma of lower lip, of which 25 had regional lymph node metastasis and 25, absence of metastasis. The percentages of cells immunostained for VEGF-C, VEGFR-3 and HIF-1α in front of tumor invasion and in the center of tumor were evaluated. Microvessel density lymphatic (MDL) was determined by the counting of lymph microvessels immunostained by the anti-D2-40 in five fields (200×), in an area of evaluation with 0.7386 mm2. The invasion of the lymph vessels by malignant cells was also evaluated. Immunostaining was correlated with the presence and absence of metastasis, TNM clinical stage, local recurrence, disease outcome (remission of injury or patient death) and histological grading. The analysis of intra and peritumoral lymphatic density showed no significant association with clinicopathological parameters and immunoexpressions of VEGF-C, VEGFR-3 and HIF-1α (p > 0,05). There was a weak positive correlation, significant, between intra and peritumoral lymphatic density (r = 0,405; p = 0,004). VEGF-C showed no significant association with clinicopathological and prognosis parameters (p > 0,05). For VEGFR-3, there was scarce membrane staining and intense and homogenous cytoplasmic staining in neoplastic cells. Percentage of positive cytoplasmic VEGFR-3 in center of tumor, exhibited a statistically significant association with metastasis (p = 0,009), patient death (p = 0,008) and histological grades of malignancy proposed by Bryne et al. (1992) (p = 0,002) and World Health Organization (p = 0,003). A low positive correlation was statistically significant between the immunoreactivity of VEGFC and VEGFR-3 cytoplasmic (r = 0,358; p = 0,011) and between the percentage of positive cytoplasmic VEGFR-3 in front of tumor invasion and in the center of the tumor (r = 0,387; p = 0,005) was also demonstrated. There was no association between HIF-1α, clinicopathological and prognosis parameters, and VEGF-C and VEGFR-3. The percentage of nuclear positivity for HIF-1α was significantly higher in cases without invasion of peritumoral lymphatic (p = 0,040). Based on the results we can conclude that most cytoplasmic expression of VEGFR-3 in center of tumor in metastatic cases, high degree of malignancy and poorly differentiated, contributes to poor outcome of squamous cell carcinoma of the lower lip, including patient death. Intra and peritumoral lymphatic density seems to be not associated with lymph node metastasis in these carcinomas

Plasticidade de células tronco mesenquimais de medula óssea de ratos na presença de meio condicionado do nervo facial e do fator de crescimento fibroblástico 2

A number of evidences show the influence of the growth of injured nerve fibers in Peripheral Nervous System (PNS) as well as potential implant stem cells (SCs) to make it more suitable for nerve regeneration medium. In this perspective, this study aimed to evaluate the plasticity of mesenchymal stem cells from bone marrow of mice in the presence of culture medium conditioned with facial nerve explants (D-10) and fibroblast growth factor-2 (FGF-2). In this perspective, the cells were cultivated only with DMEM (group 1), only with D-10(group 2), only with FGF-2(group 3) or with D-10 and FGF-2(group 4). The growth and morphology were assessed over 72 hours. Quantitative phenotypic analysis was taken from the immunocytochemistry for GFAP, OX-42, MAP-2, β-tubulin III, NeuN and NF-200 on the fourth day of cultivation. Cells cultured with conditioned medium alone or combined with FGF-2 showed distinct morphological features similar apparent at certain times with neurons and glial cells and a significant proliferative activity in groups 2 and 4 throughout the days. Cells cultived only with conditioned medium acquired a glial phenotype. Cells cultured with FGF-2 and conditioned medium expressed GFAP, OX-42, MAP-2, β-tubulin III, NeuN and NF-200. On average, area and perimeter fo the group of cells positive for GFAP and the área of the cells immunostained for OX-42 were higher than those of the group 4. This study enabled the plasticity of mesenchymal cells (MCs) in neuronal and glial nineage and opened prospects for the search with cell therapy and transdifferentiation

Adaptação e validação da escala de motivação à prática de atividades físicas

The study of the motivation to practice physical activities is relevant once through this it is possible to develop intervention strategies for sedentary population. In this way, the present dissertation aimed to adapt and validate for the Brazilian context the Motives for Physical Activity Measure Revised (MPAM-R). It was investigated yet the relation of some socio-demographic variables (age, gender, Body Mass Index - BMI, types of physical activity; way to practice and time of practice) and the participants means in the motives studied. The physical activity (PA) is defined as any bodily movement produced by skeletal muscles resulting in energy expenditure above the basal level. However, in the present study it was considered motivation for two types of PA: the physical exercises and sports. The Self-Determination Theory (SDT) underlay this research, once it has been used in the sportive context, beyond the facto of it was used as theoretical base to the development of MPAM-R. To attain the proposed goals, it was accomplished translations to Portuguese of the original English scale. Next, was carried out the semantic analysis and the judge analysis. For the empirical analysis of items, participated 309 practitioner of PA, classified in physical exercises practitioners and sports practitioners, with ages between 16 and 74 years, distributed equally by sex. They answered the final version in Portuguese of the MPAM-R and socio-demographic questions. The data was collected in Natal/RN, where the researcher approached people in some places where the PA is practiced, following she communicated that their involvement will be spontaneous and their responses will be confidential. The obtained results pointed the confirmation of the existence of five factors in the final version of the instrument, that was composed by 26 items that presented the following statistics indexes: x² (289) = 757.75, p < 0.000, x²/DF = 2.62, with GFI of 0.83, AGFI of 0.80 and RMSEA of 0.07. The reliability (Cronbach Alpha) of the complete instrument was 0.90, and the indexes of each factor were considered satisfactory too: Enjoyment (α = 0.88), Health (α = 0.84), Appearance (α = 0.79), Competence (α = 0.85) and Social (α = 0.75). It was observed that, in general, the main motive presented by the participants to practice PA was Health. It was verified yet, that women and aged had a higher mean in the Health factor; among the exercise practitioners was found a higher mean in the Appearance factor; and a higher mean in the Social factor was found among those that practice PA with accompaniment. It was concluded that the MPAM-R presented satisfactory psychometric parameters, became it useful in futures researches. Moreover, proposed the accomplishment of new studies that considered others variables to the intent of the better understanding of motivation to practice physical activity

Adaptação e validação da escala de dependência de exercício físico em versão tradicional e informatizada

While providing physical and psychological benefits, excessive exercise could be or cause a compulsive behavior, making the individual dependent on it. In a parallel discussion, computerized psychological instruments, for a hand, reflects the development of information technology and your applicability to other areas, but also shows little advance for Psychological Assessment. In this perspective, this study aims to adapt the Exercise Dependence Scale (EDS-R) in two formats (paper-and-pencil and computerized) and evaluate evidence of factorial and convergent validity, and reliability of each version and compare them with each other. It is also proposed to observe the relationship of some bio-demographic (Sex, age, frequency, duration and intensity of practice exercise) and the exercise dependence (DEF). For this purpose, 709 regular physical activity practitioners, selected by procedures non-probabilistic sampling, responded a adapted version of EDS-R, Muscle Appearance Satisfaction Scale (MASS), Body Modification Scale (BMS) and a demographic questionnaire, analyzed through Exploratory Factor Analysis, Cronbach's Alpha and not parametric tests. Both the traditional version and the computer showed a seven factors structure, explaining 57 and 62% of the variance, respectively, and Cronbach's alphas of 0.83 and 0.89. Factors were: (1) intentionality, (2) continuity, (3) tolerance, (4) reduction of other activities, (5) lack of control, (6) abstinence and (7) time spent on exercise. Relationships were observed between the Exercise Dependence and the variables: age, diets, consumption of food supplements and medicines for weight change, desire to do plastic surgery and body satisfaction. We observed also a positive correlation between the DEF and the frequency, duration and intensity of exercise, and the factor "Dependence on exercising" from MASS, indicating convergent validity of the EDS-R. Finally, comparisons between the two formats were equivalent, with few changes: computerized version achieved higher DEF scores. Based on these results, it can be concluded that the EDS-R has factorial and convergent validity, reliability, to measure exerceise dependence on traditional e computerized formats. DEF is related to actions used to body modification and behaviors toward exercise. Finally, it was found equivalence between the formats, especially in psychometric parameters, thus suggesting feasibility of a computerized assessment. However, it was observed that the computerized data has sample recruiting strategies more limited

Tradução e adaptação da escala de dependência de substâncias do Millon Clinical Multiaxial III para o Brasil

Millon describes the normal personality by means of adaptation styles that are effective in normal environments and personality disorders such as unadapted operating styles. To operacionalize his theoretical model, Millon has built several instruments, including the Millon Clinical Multiaxial Inventory III (MCMI-III), wich consists of a self report inventory composed by 175 true or false response items, containing four verification scales, and others scales wich evaluates 14 personality patterns and 10 clinical syndromes. The Substance Dependence scale (T) is placed along with Clinical Syndromes scales. This research is justified by the lack of a Brazilian instrument to assess personality psychopathological aspects, and aims to translate and semantically adapt the MCMI-III to the Brazilian context, checking validity elements of the Substance Dependence scale, and developing a computer application for assisting the evaluation of assessment results. To this intent, 2.588 individuals data was collected, male and female, aged between 18 and 85 years, characterized as belonging to a clinical or non-clinical group, who took part in the survey via the internet or in person. Respondents completed the MCMI-III, a socio-demographic questionnaire and a subgroup also answered to the Goldberg General Health Questionnaire (GHQ). Besides descriptive statistics, we performed the analysis using the Student t test, principal components analysis and internal consistency. Despite difficulties related to translating very specific English terms, the assessment by judges, experts on Millon´s theory, and the back translation, attested the adequacy of the Brazilian version. Factorial analysis indicated the grouping of translated T scale items into three factors (social activities prejudice, lack of impulse control, and oppositional behavior), by presenting a single item on a fourth factor (apparently related to seeking pleasurable stimuli). The Cronbach alpha for this set of items was 0,82, indicating an acceptable scale reliability. The data analysis resulted in distinction of scores between clinical and non-clinical groups and between men and women; the relationship between high scores on the scale T and the other scales; scores of drug users according to the declared used substance; and the relationship between high scores on T and the verification of disorder or risk on GHQ mental health factor, indicating the instrument´s adequate sensistivity in identifying psychopathologies and the relationship between the different disorders or psychopathological personality patterns. Although further studies are necessary to develop the scores transformation factors, the computerized correction tool was adequate.

Técnica de parametrização geométrica para o fluxo de carga continuado baseado nas variáveis tensão nodal e fator de carregamento

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)