929 resultados para Collusion-resistant fingerprinting
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
An outbreak of vancomycin-resistant enterococci (VRE) occurred in 2011 in several hospitals of western Switzerland. Given that VRE can spread rapidly within hospitals and due to the potential transfer of resistance genes to other nosocomial pathogens like MRSA, stringent control measures were implemented. Excellent coordination of control measures between partner healthcare settings was successful in stopping the outbreak.
Resumo:
Methicillin-resistant Staphylococcus aureus (MRSA) have developed resistance to virtually all non-experimental antibiotics. They are intrinsically resistant to beta-lactams by virtue of newly acquired low-affinity penicillin-binding protein 2A (PBP2A). Because PBP2A can build the wall when other PBPs are blocked by beta-lactams, designing beta-lactams capable of blocking this additional target should help solve the issue. Older molecules including penicillin G, amoxicillin and ampicillin had relatively good PBP2A affinities, and successfully treated experimental endocarditis caused by MRSA, provided that the bacterial penicillinase could be inhibited. Newer anti-PBP2A beta-lactams with over 10-fold greater PBP2A affinities and low minimal inhibitory concentrations were developed, primarily in the cephem and carbapenem classes. They are also very resistant to penicillinase. Most have demonstrated anti-MRSA activity in animal models of infection, and two--the carbapenem CS-023 and the cephalosporin ceftopibrole medocaril--have proceeded to Phase II and Phase III clinical evaluation. Thus, clinically useful anti-MRSA beta-lactams are imminent.
Resumo:
The objective of this research was to evaluate the effect of the insect resistant soybean genotype IAC 17 on reproductive characteristics of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) females compared to the soybean insect susceptible genotype UFV 16. Treatments were: T1) females of P. nigrispinus fed on plants of the UFV 16 and Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae) caterpillars reared on leaves of this variety; T2) females of P. nigrispinus fed on plants of the IAC 17 and A. gemmatalis caterpillars reared on leaves of this variety. Longevity of females, pre-oviposition, oviposition and pos-oviposition periods, number of eggs and egg masses/female, egg weight, interval between egg mass laying, number of eggs/egg mass, percentage of nymphs, number of nymphs/female and total number of prey killed/female of P. nigrispinus were evaluated. Most of the characteristics evaluated showed similar results between treatments, but the oviposition period was longer for females reared on the resistant genotype than on the susceptible one and the percentage of total females that laid eggs was lower on the IAC 17. Also, the resistant genotype caused higher mortality of P. nigrispinus females at the beginning of its adult stage and egg production by females of this predator was better spread along its adult stage with this resistant genotype. On the other hand, results suggest no effect of the resistant genotype on the offspring of this predator.
Resumo:
Background: A hospitalised patient infected with MRSA was found to harbour a VISA strain after 6 weeks of treatment with vancomycin. Additional contact measures were reinforced according to CDCs recommendations. We decide to evaluate if these applied control measures were effective. Objective: To evaluate the efficacy of strict additional contact measures to contain the dissemination of VISA from an infected patient. Methods: All patients from the unit were screened weekly for MRSA during a 6-week period, whereas health care workers (HCW) were screened only once. Screening specimen included nose, throat, groin, and clinical specimens for patients, and only nose and throat for HCW. Broth enrichment and chromogenic agar (MRSA-select) were used for MRSA detection. All MRSA isolates were tested on Van screen plates, and growing colonies were tested for MIC of vancomycin. MIC was performed using Etest. Population analysis was done for VISA confirmation. One strain per person was typed by Double Locus Sequence Typing (based on clfB and spa sequencing). Results: 66 patients hospitalized in the same service during the 6 weeks and 55 HCW were screened for MRSA and VISA. MRSA was found in 16/66 (24%) patients and 1/55 (2%) HCW. 16/17 MRSA from patients belonged to the same genotype that the VISA strain. The remaining patient had a MRSA identical to the HCW isolate. Among the 16 MRSA isolates sharing the same genotype than the VISA strain, two showed Etests vancomycin MIC of only 4 mg/L. MIC results were confirmed by the population analysis. They were not considered as VISA, but as MRSA with increased vancomycin MICs. Both isolates were obtained from two roommates. Conclusion: Strict additional contact measures were found to be effective to contain VISA dissemination. However, the identification of two isolates with increased vancomycin MIC (4 mg/L) in two roommates raised the question of the need to routinely test this susceptibility and of adequate control measures for patients harbouring such isolates.
Resumo:
The prevalence of resistant hypertension ranges between 5-30%. Patients with resistant hypertension are at increased risk of cardiovascular events. Radiofrequency renal denervation is a recent and promising technique that can be used in the setting of resistant hypertension. However, long-term safety and efficacy data are lacking and evidence to use this procedure outside the strict setting of resistant hypertension is missing. The aim of the article is to propose a common work-up for nephrologists, hypertensiologists, cardiologists and interventional radiologists in order to avoid inappropriate selection of patients and a possible misuse of this procedure.
Resumo:
Objective: To describe an ongoing outbreak that tripled the annual detection of methicillin-resistant Staphylococcus aureus (MRSA) carriage in a tertiary care hospital. Methods: Active surveillance of MRSA is performed since 20 years in our hospital. Our protocol includes screening of patients transferred from high-incidence health-care institutions or countries, roommates of new MRSA cases, and wards where _2 patients acquired MRSA during the same week. Contact precautions are used for known carriers. PFGE was used for molecular typing until 2004, and was then replaced by Double-Locus Sequence Typing (DLST). Results: A median yearly incidence of 173 new carriers of MRSA was observed from 2002 to 2007. Since September 2008, an increasing number of new cases were observed, mainly as successive clusters limited to distinct wards, reaching a total of 398 until October 2009. The yearly incidence of new cases rose to 275 in 2008 and 613 in 2009. 60% of the cases were due to one strain: DLST 4−4, ST 228, SCCmecI. The incidence of new cases due to the previously predominant strains remained unchanged. The epidemic strain corresponded to a new variant of a clone responsible for a previous outbreak in 2001, and only sporadically isolated (mean of 20 cases/year) since then. A case- control study documented a significant association between acquisition of the epidemic strain and a stay in intensive and intermediary care units, a highest number of internal transfers, but did not identify a point source of transmission. Infection control practices and antibiotic policy had remained unchanged for several years. Compliance with handhygiene as monitored yearly was on the rise. Screening of 313 healthcare workers only found one carrier of the epidemic strain lately in the outbreak. Additional infection control measures were enforced, including screening at ICU admission and discharge with PCR-based rapid test, routine screening for all patients leaving epidemic wards, introduction of PCR-based rapid test for contact tracing, additional working forces for environmental disinfection, and hospital-wide education of healthcare workers. However, the outbreak was still ongoing after 5 months. Conclusions: Factors linked to the dissemination of this new variant in our institution remain undetermined. This unresolved outbreak suggests that this new variant acquired hyperepidemic properties, which calls for further investigations.
Resumo:
The persistence of high blood pressure under antihypertensive treatment (resistant hypertension) entails an increased cardiovascular risk. It occurs in three of ten treated hypertensive patients, and has several possible contributing factors, notably insufficient therapeutic adherence. There are a number of ways to evaluate whether patients take their medication as prescribed. These include interviewing the patient, pill counting, prescription follow-up, assay of drugs in blood or urine, and use of electronic pill dispensers. None is perfect. However, the essential is to discuss with the patient the importance of complying with the treatment as soon as it is prescribed for the first time, and not waiting for the appearance of resistant hypertension. The measurement of blood pressure outside the medical office and the monitoring of adherence may help to identify patients in whom hypertension is truly resistant and so to tailor the measures required to improve the control of blood pressure in the most appropriate manner.
Resumo:
Background and Aims: Although systemic corticosteroids are successfully administered for the induction of clinical response and remission in the majority of patients with inflammatory bowel disease (IBD) presenting with a flare, a proportion of these patients demonstrate a primary nonresponse to steroids or in the case of an initial response, they develop a resistance or a steroid dependence. Long-term therapy with corticosteroids for treatment of IBD should be avoided, given the high frequency of adverse treatment effects. Knowledge about treatment strategies in case of steroid nonresponse is therefore highly relevant. Methods: A systematic literature research was performed using Medline and Embase to summarize the currently recommended treatment strategies for steroid-resistant IBD. Results: Treatment of steroid-resistant Crohn's disease is based on the introduction of immunomodulators such as azathioprine, 6-mercaptopurine or methotrexate, the anti-TNF drugs infliximab, adalimumab and certolizumab pegol. In the case of steroid resistance in ulcerative colitis, aminosalicylates, the above-mentioned immunomodulators, infliximab, adalimumab or calcineurin inhibitors such as ciclosporin or tacrolimus may be administered. Conclusion: This review summarizes the current evidence for treating steroid-resistant IBD.
Resumo:
In vitro and in vivo activity of amoxicillin and penicillin G alone or combined with a penicillinase inhibitor (clavulanate) were tested against five isogenic pairs of methicillin-resistant Staphylococcus aureus (MRSA) producing or not producing penicillinase. Loss of the penicillinase plasmid caused an eight times or greater reduction in the MICs of amoxicillin and penicillin G (from greater than or equal to 64 to 8 micrograms/ml), but not of the penicillinase-resistant drugs methicillin and cloxacillin (greater than or equal to 64 micrograms/ml). This difference in antibacterial effectiveness correlated with a more than 10 times greater penicillin-binding protein 2a affinity of amoxicillin and penicillin G than of methicillin and a greater than or equal to 90% successful amoxicillin treatment of experimental endocarditis due to penicillinase-negative MRSA compared with cloxacillin, which was totally ineffective (P less than .001). Amoxicillin was also effective against penicillinase-producing parent MRSA, provided it was combined with clavulanate. Penicillinase-sensitive beta-lactam antibiotics plus penicillinase inhibitors might offer a rational alternative treatment for MRSA infections.
Resumo:
During a 1-year period, 87 methicillin-resistant Staphylococcus aureus isolates were collected from 4 major Cuban hospitals for epidemiological analysis. The majority (86%) were related to the community-associated USA300 clone, whereas the remaining belonged to a new clone ST72-V. Interestingly, no hospital-associated clone was found in these Cuban hospitals.