A 5'-upstream region of a bovine keratin 6 gene confers tissue-specific expression and hyperproliferation-related induction in transgenic mice.

Keratins, the constituents of epithelial intermediate filaments, are precisely regulated in a tissue- and development-specific manner, although little is known about the molecular mechanisms underlying this regulation. The expression pattern of keratin 6 is particularly complex, since besides being constitutively expressed in hair follicles and in suprabasal cells of a variety of internal stratified epithelia, it is induced in epidermis in both natural and artificially caused hyperproliferative situations. Therefore, the regulatory sequences controlling keratin 6 gene activity are particularly suitable for target gene expression in a tissue-specific manner. More interestingly, they can be skin-induced in transgenic animals or in gene therapy protocols, particularly those addressing epidermal hyperproliferative disorders. To delimit the regions containing these regulatory elements, different parts of the bovine keratin 6 gene linked to a beta-galactosidase reporter gene have been assayed in transgenic mice. A 9-kbp fragment from the 5' upstream region was able to provide both suprabasal tissue-specific and inducible reporter expression.

Disruption of the gene for hsp30, an alpha-crystallin-related heat shock protein of Neurospora crassa, causes defects in thermotolerance.

The alpha-crystallin-related heat shock proteins are produced by all eukaryotes, but the role of these proteins in thermoprotection remains unclear. To investigate the function of one of these proteins, we disrupted expression of the single-copy hsp30 gene of Neurospora crassa, using repeat-induced point mutagenesis, and we generated and characterized mutant strains that were deficient in hsp30 synthesis. These strains could grow at high temperature and they acquired thermotolerance from a heat shock. However, the hsp30-defective strains proved to be extremely sensitive to the combined stresses of high temperature and carbohydrate limitation, enforced by the addition of a nonmetabolizable glucose analogue. Under these conditions, their survival was reduced by 90% compared with wild-type cells. This sensitive phenotype was reversed by reintroduction of a functional hsp30 gene into the mutant strains. The mutant cells contained mitochondria from which a 22-kDa protein was readily extracted with detergents, in contrast to its retention by the mitochondria of wild-type cells. Antibodies against hsp30 coimmunoprecipitated a protein also of approximately 22 kDa from wild-type cells. Results of this study suggest that hsp30 may be important for efficient carbohydrate utilization during high temperature stress and that it may interact with other mitochondrial membrane proteins and function as a protein chaperone.

The disease-resistance gene Pto and the fenthion-sensitivity gene fen encode closely related functional protein kinases.

Resistance to bacterial speck in tomato is governed by a gene-for-gene interaction in which a single resistance locus (Pto) in the plant responds to the expression of a specific avirulence gene (avrPto) in the pathogen. Disease susceptibility results if either Pto or avrPto are lacking from the corresponding organisms. Leaves of tomato cultivars that contain the Pto locus also exhibit a hypersensitive-like response upon exposure to an organophosphorous insecticide, fenthion. Recently, the Pto gene was isolated by a map-based cloning approach and was shown to be a member of a clustered multigene family with similarity to various protein-serine/threonine kinases. Another member of this family, termed Fen, was found to confer sensitivity to fenthion. The Pto protein shares 80% identity (87% similarity) with Fen. Here, Pto and Fen are shown to be functional protein kinases that probably participate in the same signal transduction pathway.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Differential modulation of Th1- and Th2-related cytokine mRNA expression by a synthetic peptide homologous to a conserved domain within retroviral envelope protein.

The influence of a synthetic retroviral peptide, CKS-17, on T helper type 1 (Th1)- or Th2-related cytokines was investigated in human blood mononuclear cells. Cells were stimulated with staphylococcal enterotoxin A, anti-CD3 plus anti-CD28 monoclonal antibodies, or lipopolysaccharide to induce cytokine mRNA. mRNA was detected by a reverse transcription-polymerase chain reaction or Northern blot analysis. CKS-17 down-regulated stimulant-induced mRNA accumulation for interferon gamma (IFN-gamma), interleukin (IL)-2, and p40 heavy and p35 light chains of IL-12, a cytokine that mediates development of Th1 response. CKS-17 up-regulated stimulant-induced mRNA accumulation of IL-10 and did not suppress Th2-related cytokine (IL-4, IL-5, IL-6, or IL-13) mRNA expression. A reverse sequence of CKS-17 peptide, used as a control, showed no such action. Anti-human IL-10 monoclonal antibody blocked ability of CKS-17 to inhibit mRNA accumulation for IFN-gamma but not the CKS-17 suppressive activity of IL-12 p40 heavy chain mRNA. Thus, CKS-17-mediated suppression of IFN-gamma mRNA expression is dependent upon augmentation of IL-10 production by CKS-17. This conserved component of several retroviral envelope proteins, CKS-17, may act as an immunomodulatory epitope responsible for cytokine dysregulation that leads to suppression of cellular immunity.

Expression of the tudor-related gene Tdrd5 during development of the male germline in mice

Homologues of Drosophila germ cell determinant genes such as vasa, nanos and tudor have recently been implicated in development of the male germline in mice. In the present study, the mouse gene encoding Tudor domain containing protein 5 (TDRD5) was isolated from a 12.5-13.5 days post coitum (dpc) male-enriched subtracted cDNA library. Whole-mount in situ hybridization analysis of Tdrd5 expression in the mouse embryonic gonad indicated that this gene is upregulated in the developing testis from 12.5 dpc, with expression levels remaining higher in testis than ovary throughout embryogenesis. Expression of Tdrd5 was absent in testes isolated from W-e/W-e embryos, which lack germ cells. In situ hybridization (ISH) on cryosectioned 13.5 dpc testes suggests that expression of Tdrd5, like that of Oct4, is restricted to germ cells. Northern hybridization analysis of expression in adult tissues indicated that Tdrd5 is expressed in the testis only, implying that expression of this gene is restricted to the male germline throughout development to adulthood. (C) 2004 Elsevier B.V. All rights reserved.

Increased duodenal expression of divalent metal transporter 1 and iron-regulated gene 1 in cirrhosis

Hepatic hemosiderosis and increased iron absorption are common findings in cirrhosis. It has been proposed that a positive relation exists between intestinal iron absorption and the development of hepatic hemosiderosis. The current study investigated the duodenal expression of the iron transport molecules divalent metal transporter 1 (DMT1 [IRE]), iron-regulated gene 1 (Ireg1 [ferroportin]), hephaestin, and duodenal cytochrome b (Dyctb) in 46 patients with cirrhosis and 20 control subjects. Total RNA samples were extracted from duodenal biopsy samples and the expression of the iron transport genes was assessed by ribonuclease protection assays. Expression of DMT1 and Ireg1 was increased 1.5 to 3-fold in subjects with cirrhosis compared with iron-replete control subjects. The presence of cirrhosis per se and serum ferritin (SF) concentration were independent factors that influenced the expression of DMT1. However, only SF concentration was independently associated with Iregl expression. In cirrhosis, the expression of DMT1 and Iregl was not related to the severity of liver disease or cirrhosis type. There was no correlation between the duodenal expression of DMT1 and Iregl and the degree of hepatic siderosis. In conclusion, the presence of cirrhosis is an independent factor associated with increased expression of DMT1 but not Iregl. The mechanism by which cirrhosis mediates this change in DMT1 expression has yet to be determined. Increased expression of DMT1 may play an important role in the pathogenesis of cirrhosis-associated hepatic iron overload.

Identification and analysis of venom gland-specific genes from the coastal taipan (Oxyuranus scutellatus) and related species

Australian terrestrial elapid snakes contain amongst the most potently toxic venoms known. However, despite the well-documented clinical effects of snake bite, little research has focussed on individual venom components at the molecular level. To further characterise the components of Australian elapid venoms, a complementary (cDNA) microarray was produced from the venom gland of the coastal taipan (Oxyuranus scutellatus) and subsequently screened for venom gland-specific transcripts. A number of putative toxin genes were identified, including neurotoxins, phospholipases, a pseudechetoxin-like gene, a venom natriuretic peptide and a nerve growth factor together with other genes involved in cellular maintenance. Venom gland-specific components also included a calglandulin-like protein implicated in the secretion of toxins from the gland into the venom. These toxin transcripts were subsequently identified in seven other related snake species, producing a detailed comparative analysis at the cDNA and protein levels. This study represents the most detailed description to date of the cloning and characterisation of different genes associated with envenomation from Australian snakes.

The detection of environmental autoinducing peptide quorum-sensing genes from an uncultured Clostridium sp in landfill leachate reactor biomass

Aims: To elucidate whether a dominant uncultured clostridial (Clostridium thermocellum-like) species in an environmental sample (landfill leachate), possesses an autoinducing peptide (AIP) quorum-sensing (QS) gene, although it may not be functional. Methods and Results: A modified AIP accessory gene regulator (agr)C PCR protocol was performed on extracted DNA from a landfill leachate sample (also characterized by 16S rRNA gene cloning) and the PCR products were cloned, sequenced and phylogenetically analysed. It appeared that two agrC gene phylotypes existed, most closely related to the C. thermocellum agrC gene, differing by only 1 bp. Conclusions: It is possible to specifically identify and characterize the agrC AIP QS gene from uncultured Firmicutes (C. thermocellum-like) bacteria derived from environmental (landfill leachate) sample. Significance and Impact of the Study: This is the first successful attempt at identifying AIP QS genes from a cellulolytic environment (landfill). The agrC gene was identified as being most closely related to the C. thermocellum agrC gene, the same bacterium identified as being dominant, according to 16S rRNA gene cloning and subsequently fluorescence in situ hybridization analyses, in the same biomass.

Characterisation of calcitonin generelated peptide (CGRP) and amylin receptors

The aims of this study were to examine the binding characteristics of the rat CGRP receptor and to further the classification of CGRP and amylin receptors in guinea-pig tissue preparations. Binding characteristics of CGRP were investigated on rat splenic, cerebellar and liver membrane preparations. Human-α-CGRP, rat-α-CGRP and the CGRP receptor analogues Tyrº -CGRPC28-37) and [Cys (ACM)2,7 ]-human CGRP and the CGRP receptor antagonist CGRPC8-37) were utilised in competitive radioligand binding experiments to identify possible CGRP receptor subtypes in these tissues. There appeared to be no significant differences between the rat CGRP receptors examined. A panel of monoclonal antibodies (Mabs) raised against CGRP were employed to investigate the structure-activity relationships of CGRP and its receptor. No differences between the tissue receptors were observed using this panel of Mabs. The effects of human-α, human-β, rat-α-CGRP, human and rat amylin and adrenomedullin(13-52) were examined on the spontaneously beating right atria and on electrically evoked twitch contractions of isolated guinea-pig ileum, vas deferens and left atria. All of the peptides caused concentration-dependent inhibition of twitch amplitude in the ileum and vas deferens. CGRP produced positive inotropic effects in the right and left atria and positive chronotropic effects in the right atria. A variety of CGRP receptor antagonists and putative amylin receptor antagonists were used to antagonise these effects. CGRP(8-37) is currently used as a basis for CGRP receptor classification (Dennis, et al., 1989). Based upon results obtained using CGRP(8-37) it has been shown that the guinea-pig ileum contains mainly CGRP 1 receptors and the vas deferens contain CGRP2 receptors. Amylin was shown to act at receptors distinct from those for CGRP and it is postulated that amylin has its own receptors in these preparations. Experiments using CGRP (19-37) and Tyrº -CGRP(28-37) indicate that human and rat CGRP act at distinct receptors in guinea-pig ileum and vas deferens. The amylin receptor antagonist amylin(8-37) and the putative antagonist AC187 provide evidence to suggest human and rat amylin also act at receptors able to distinguish between the two types of amylin.

The Val66Met polymorphism of the BDNF gene influences trigeminal Pain-Related evoked responses

Cortical pain processing is associated with large-scale changes in neuronal connectivity, resulting from neural plasticity phenomena of which brain-derived neurotrophic factor (BDNF) is a central driver. The common single nucleotide polymorphism Val66Met is associated with reduced BDNF activity. Using the trigeminal pain-related evoked potential (tPREP) to repeated electrical painful stimuli, we investigated whether the methionine substitution at codon 66 of the BDNF gene was associated with changes in cortical processing of noxious stimuli. Fifty healthy volunteers were genotyped: 30 were Val/Val and 20 were Met-carriers. tPREPs to 30 stimuli of the right supraorbital nerve using a concentric electrode were recorded. The N2 and P2 component latencies and the N2-P2 amplitude were measured over the 30 stimuli and separately, by dividing the measurements in 3 consecutive blocks of 10 stimuli. The average response to the 30 stimuli did not differ in latency or amplitude between the 2 genotypes. There was a decrease in the N2-P2 amplitude between first and third block in the Val/Val group but not in Met-carriers. BDNF Val66Met is associated with reduced decremental response to repeated electrical stimuli, possibly as a result of ineffective mechanisms of synaptic memory and brain plasticity associated with the polymorphism. PERSPECTIVE: BDNF Val66Met polymorphism affects the tPREP N2-P2 amplitude decrement and influences cortical pain processing through neurotrophin-induced neural plasticity, or through a direct BDNF neurotransmitter-like effect. Our findings suggest that upcoming BDNF central agonists might in the future play a role in pain management.