938 resultados para Basophil Degranulation Test -- methods


Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: The objective is to develop a cost-effective, reliable and non invasive screening test able to detect early CRCs and adenomas. This is done on a nucleic acids multigene assay performed on peripheral blood mononuclear cells (PBMCs). METHODS: A colonoscopy-controlled study was conducted on 179 subjects. 92 subjects (21 CRC, 30 adenoma >1 cm and 41 controls) were used as training set to generate a signature. Other 48 subjects kept blinded (controls, CRC and polyps) were used as a test set. To determine organ and disease specificity 38 subjects were used: 24 with inflammatory bowel disease (IBD),14 with other cancers (OC). Blood samples were taken and PBMCs were purified. After the RNA extraction, multiplex RT-qPCR was applied on 92 different candidate biomarkers. After different univariate and multivariate analysis 60 biomarkers with significant p-values (<0.01) were selected. 2 distinct biomarker signatures are used to separate patients without lesion from those with CRC or with adenoma, named COLOX CRC and COLOX POL. COLOX performances were validated using random resampling method, bootstrap. RESULTS: COLOX CRC and POL tests successfully separate patients without lesions from those with CRC (Se 67%, Sp 93%, AUC 0.87), and from those with adenoma > 1cm (Se 63%, Sp 83%, AUC 0.77). 6/24 patients in the IBD group and 1/14 patients in the OC group have a positive COLOX CRC. CONCLUSION: The two COLOX tests demonstrated a high Se and Sp to detect the presence of CRCs and adenomas > 1 cm. A prospective, multicenter, pivotal study is underway in order to confirm these promising results in a larger cohort.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Question: When multiple observers record the same spatial units of alpine vegetation, how much variation is there in the records and what are the consequences of this variation for monitoring schemes to detect change? Location: One test summit in Switzerland (Alps) and one test summit in Scotland (Cairngorm Mountains). Method: Eight observers used the GLORIA protocols for species composition and visual cover estimates in percent on large summit sections (>100 m2) and species composition and frequency in nested quadrats (1 m2). Results: The multiple records from the same spatial unit for species composition and species cover showed considerable variation in the two countries. Estimates of pseudoturnover of composition and coefficients of variation of cover estimates for vascular plant species in 1m x 1m quadrats showed less variation than in previously published reports whereas our results in larger sections were broadly in line with previous reports. In Scotland, estimates for bryophytes and lichens were more variable than for vascular plants. Conclusions: Statistical power calculations indicated that, unless large numbers of plots were used, changes in cover or frequency were only likely to be detected for abundant species (exceeding 10% cover) or if relative changes were large (50% or more). Lower variation could be reached with the point methods and with larger numbers of small plots. However, as summits often strongly differ from each other, supplementary summits cannot be considered as a way of increasing statistical power without introducing a supplementary component of variance into the analysis and hence the power calculations.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Early detection of neural-tude defects is possible by determining Alpha-fetoprotein (AFP) in maternal serum. 16'685 pregnant women were observed. Three methods for the determination of the "normal" range are compared. The first one, already used in similar studies, makes use of a constant multiple of the median. The other two ones make use of robust estimates of location and scale. Their comparison shows the interest of the robust methods to reduce the interlaboratory variability.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Several methods and algorithms have recently been proposed that allow for the systematic evaluation of simple neuron models from intracellular or extracellular recordings. Models built in this way generate good quantitative predictions of the future activity of neurons under temporally structured current injection. It is, however, difficult to compare the advantages of various models and algorithms since each model is designed for a different set of data. Here, we report about one of the first attempts to establish a benchmark test that permits a systematic comparison of methods and performances in predicting the activity of rat cortical pyramidal neurons. We present early submissions to the benchmark test and discuss implications for the design of future tests and simple neurons models

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Detection rates for adenoma and early colorectal cancer (CRC) are unsatisfactory due to low compliance towards invasive screening procedures such as colonoscopy. There is a large unmet screening need calling for an accurate, non-invasive and cost-effective test to screen for early neoplastic and pre-neoplastic lesions. Our goal is to identify effective biomarker combinations to develop a screening test aimed at detecting precancerous lesions and early CRC stages, based on a multigene assay performed on peripheral blood mononuclear cells (PBMC).Methods: A pilot study was conducted on 92 subjects. Colonoscopy revealed 21 CRC, 30 adenomas larger than 1 cm and 41 healthy controls. A panel of 103 biomarkers was selected by two approaches: a candidate gene approach based on literature review and whole transcriptome analysis of a subset of this cohort by Illumina TAG profiling. Blood samples were taken from each patient and PBMC purified. Total RNA was extracted and the 103 biomarkers were tested by multiplex RT-qPCR on the cohort. Different univariate and multivariate statistical methods were applied on the PCR data and 60 biomarkers, with significant p-value (< 0.01) for most of the methods, were selected.Results: The 60 biomarkers are involved in several different biological functions, such as cell adhesion, cell motility, cell signaling, cell proliferation, development and cancer. Two distinct molecular signatures derived from the biomarker combinations were established based on penalized logistic regression to separate patients without lesion from those with CRC or adenoma. These signatures were validated using bootstrapping method, leading to a separation of patients without lesion from those with CRC (Se 67%, Sp 93%, AUC 0.87) and from those with adenoma larger than 1cm (Se 63%, Sp 83%, AUC 0.77). In addition, the organ and disease specificity of these signatures was confirmed by means of patients with other cancer types and inflammatory bowel diseases.Conclusions: The two defined biomarker combinations effectively detect the presence of CRC and adenomas larger than 1 cm with high sensitivity and specificity. A prospective, multicentric, pivotal study is underway in order to validate these results in a larger cohort.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

OBJECTIVE: Accuracy studies of Patient Safety Indicators (PSIs) are critical but limited by the large samples required due to low occurrence of most events. We tested a sampling design based on test results (verification-biased sampling [VBS]) that minimizes the number of subjects to be verified. METHODS: We considered 3 real PSIs, whose rates were calculated using 3 years of discharge data from a university hospital and a hypothetical screen of very rare events. Sample size estimates, based on the expected sensitivity and precision, were compared across 4 study designs: random and VBS, with and without constraints on the size of the population to be screened. RESULTS: Over sensitivities ranging from 0.3 to 0.7 and PSI prevalence levels ranging from 0.02 to 0.2, the optimal VBS strategy makes it possible to reduce sample size by up to 60% in comparison with simple random sampling. For PSI prevalence levels below 1%, the minimal sample size required was still over 5000. CONCLUSIONS: Verification-biased sampling permits substantial savings in the required sample size for PSI validation studies. However, sample sizes still need to be very large for many of the rarer PSIs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A program of A (90 day moist room), B (14 day moist room) and C (7 day moist room and 7 day 50%_humidity) type curing for the R-11-Z program of durability of concrete using the automatic freeze and thaw machine (ASTM C-291) has been used in the Materials Department of the Iowa State Highway Commission since December 6, 1966. A summary of the results obtained from then until March 25, 1968, indicates that the B and C type curing are yielding very little valuable information. However, the A cure exhibits a wide range of durability factors and also groups the aggregates in an order which is related to the service record (there are definite exceptions. The biggest disadvantage to the A cure is the length of time that it takes to complete the test (90 day cure and 38 day test). The Kansas Highway Department has experimented with different cements and aggregates in order to determine which combination offers a concrete with the best durability factor possible. In an experimental test section of highway, concrete made with a Type II cement appeared to have better durability than others made with Type I cements. Because of this, a question has been raised at the Iowa State Highway Commission - Can concrete made with Type II cements, because of a lesser amount of tricalcium aluminate, yield better durability than concrete made with Type I cements?

Relevância:

30.00% 30.00%

Publicador:

Resumo:

There has been relatively little change over recent decades in the methods used in research on self-reported delinquency. Face-to-face interviews and selfadministered interviews in the classroom are still the predominant alternatives envisaged. New methods have been brought into the picture by recent computer technology, the Internet, and an increasing availability of computer equipment and Internet access in schools. In the autumn of 2004, a controlled experiment was conducted with 1,203 students in Lausanne (Switzerland), where "paper-and-pencil" questionnaires were compared with computer-assisted interviews through the Internet. The experiment included a test of two different definitions of the (same) reference period. After the introductory question ("Did you ever..."), students were asked how many times they had done it (or experienced it), if ever, "over the last 12 months" or "since the October 2003 vacation". Few significant differences were found between the results obtained by the two methods and for the two definitions of the reference period, in the answers concerning victimisation, self-reported delinquency, drug use, failure to respond (missing data). Students were found to be more motivated to respond through the Internet, take less time for filling out the questionnaire, and were apparently more confident of privacy, while the school principals were less reluctant to allow classes to be interviewed through the Internet. The Internet method also involves considerable cost reductions, which is a critical advantage if self-reported delinquency surveys are to become a routinely applied method of evaluation, particularly so in countries with limited resources. On balance, the Internet may be instrumental in making research on self-reported delinquency far more feasible in situations where limited resources so far have prevented its implementation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objectives of this work were to estimate the genetic and phenotypic parameters and to predict the genetic and genotypic values of the selection candidates obtained from intraspecific crosses in Panicum maximum as well as the performance of the hybrid progeny of the existing and projected crosses. Seventy-nine intraspecific hybrids obtained from artificial crosses among five apomictic and three sexual autotetraploid individuals were evaluated in a clonal test with two replications and ten plants per plot. Green matter yield, total and leaf dry matter yields and leaf percentage were evaluated in five cuts per year during three years. Genetic parameters were estimated and breeding and genotypic values were predicted using the restricted maximum likelihood/best linear unbiased prediction procedure (REML/BLUP). The dominant genetic variance was estimated by adjusting the effect of full-sib families. Low magnitude individual narrow sense heritabilities (0.02-0.05), individual broad sense heritabilities (0.14-0.20) and repeatability measured on an individual basis (0.15-0.21) were obtained. Dominance effects for all evaluated characteristics indicated that breeding strategies that explore heterosis must be adopted. Less than 5% increase in the parameter repeatability was obtained for a three-year evaluation period and may be the criterion to determine the maximum number of years of evaluation to be adopted, without compromising gain per cycle of selection. The identification of hybrid candidates for future cultivars and of those that can be incorporated into the breeding program was based on the genotypic and breeding values, respectively. The prediction of the performance of the hybrid progeny, based on the breeding values of the progenitors, permitted the identification of the best crosses and indicated the best parents to use in crosses.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .