979 resultados para semi-aqueous capillary electrophoresis
Resumo:
The determination of 2,4-D (2,4-dichlorophenoxyacetic acid) and Dicamba (2-methoxy-3,6-dichlorobenzoic acid) residues in sugar cane, rice and corn was performed by a supercritical fluid extraction (SFE) method using CO2/acetone as extraction mix and an SFE apparatus developed in our laboratory. The extracts were cleaned up after extraction by both liquid- liquid partition and a Florisil column. Micellar electrokinetic capillary chromatography (MEKC) coupled with ultraviolet on-column detection was used for the analysis of these pesticides. The detection limits were improved by the preparation of a special detection cell with an increased pathlength that gave detection limits of ca. 0.6 pg for 2,4-D and Dicamba. Our results demonstrated that capillary electrophoresis can be a powerful new analytical tool for pesticide residue analysis.
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10 0 to 10 7 bacteria/ ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10 2bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10 4 bacteria/ ml while for silver stained 8 % polyacrylamide gel it was 10 2 bacteria/ ml. PCR with fluorescent capillary electrophoresis is an efficient and rapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary control in artificial insemination centers.
Resumo:
The intension of this paper was to review and discuss some of the current quantitative analytical procedures which are used for quality control of pharmaceutical products. The selected papers were organized according to the analytical technique employed. Several techniques like ultraviolet/visible spectrophotometry, fluorimetry, titrimetry, electroanalytical techniques, chromatographic methods (thin-layer chromatography, gas chromatography and high-performance liquid chromatography), capillary electrophoresis and vibrational spectroscopies are the main techniques that have been used for the quantitative analysis of pharmaceutical compounds. In conclusion, although simple techniques such as UV/VIS spectrophotometry and TLC are still extensively employed, HPLC is the most popular instrumental technique used for the analysis of pharmaceuticals. Besides, a review of recent works in the area of pharmaceutical analysis showed a trend in the application of techniques increasingly rapid such as ultra performance liquid chromatography and the use of sensitive and specific detectors as mass spectrometers.
Resumo:
Background and Purpose: The circadian rhythm of melatonin in saliva or plasma, or of the melatonin metabolite 6-sulfatoxymelatonin (a6MTs) in urine, is a defining feature of suprachiasmatic nucleus (SCN) function, the body's endogenous oscillatory pacemaker. The primary objective of this review is to ascertain the clinical benefits and limitations of current methodologies employed for detection and quantification of melatonin in biological fluids and tissues. Data Identification: A search of the English-language literature (Medline) and a systematic review of published articles were carried out. Study Selection: Articles that specified both the methodology for quantifying melatonin and indicated the clinical purpose were chosen for inclusion in the review. Data Extraction: The authors critically evaluated the methodological issues associated with various tools and techniques (e.g. standards, protocols, and procedures). Results of Data Synthesis: Melatonin measurements are useful for evaluating problems related to the onset or offset of sleep and for assessing phase delays or advances of rhythms in entrained individuals. They have also become an important tool for psychiatric diagnosis, their use being recommended for phase typing in patients suffering from sleep and mood disorders. Additionally, there has been a continuous interest in the use of melatonin as a marker for neoplasms of the pineal region. Melatonin decreases such as found with aging are or post pinealectomy can cause alterations in the sleep/wake cycle. The development of sensitive and selective methods for the precise detection of melatonin in tissues and fluids has increasingly been shown to have direct relevance for clinical decision making. Conclusions: Due to melatonin's low concentration, as well as the coexistence of numerous other compounds in the blood, the routine determination of melatonin has been an analytical challenge. The available evidence indicates however that these challenges can be overcome and consequently that evaluation of melatonin's presence and activity can be an accessible and useful tool for clinical diagnosis. © Springer-Verlag 2010.
Resumo:
In 2010 QIAGEN® launched to eight kits of different combinations of STRs, including the Investigator IDplex Kit. This kit allows amplification in one PCR 16 markers. The aim of this study was to evaluate the reproducibility of Investigator IDplex Kit among Latin America laboratories. In the framework of the 'III International Theoretical-Practice Course in Populations Genetic and Biologicals Filiations' in Medellín-Colombia, all participants were invited to evaluate the reproducibility of this kit, they were provided of the necessary materials for the study. The results reported by participating were tabulated for the study the reproducibility. Results and comments were received on the agreed date of 12 of the 22 laboratories registered, one participant submits comments only. Some laboratories reported greater sensitivity Investigator IDplex Kit compared with other kits containing similar markers, also highlight the easy adaptability to existing conditions in laboratories, without involving major changes to its implementation. This paper shows the high reproducibility of Investigator IDplex Kit, a new tool offered by QIAGEN® for all laboratories that perform human identification testing and biological relationship testing using DNA markers. © 2011 Elsevier B.V.
Resumo:
Metagenomics has been widely employed for discovery of new enzymes and pathways to conversion of lignocellulosic biomass to fuels and chemicals. In this context, the present study reports the isolation, recombinant expression, biochemical and structural characterization of a novel endoxylanase family GH10 (SCXyl) identified from sugarcane soil metagenome. The recombinant SCXyl was highly active against xylan from beechwood and showed optimal enzyme activity at pH 6,0 and 45°C. The crystal structure was solved at 2.75 Å resolution, revealing the classical (β/α)8-barrel fold with a conserved active-site pocket and an inherent flexibility of the Trp281-Arg291 loop that can adopt distinct conformational states depending on substrate binding. The capillary electrophoresis analysis of degradation products evidenced that the enzyme displays unusual capacity to degrade small xylooligosaccharides, such as xylotriose, which is consistent to the hydrophobic contacts at the +1 subsite and low-binding energies of subsites that are distant from the site of hydrolysis. The main reaction products from xylan polymers and phosphoric acid-pretreated sugarcane bagasse (PASB) were xylooligosaccharides, but, after a longer incubation time, xylobiose and xylose were also formed. Moreover, the use of SCXyl as pre-treatment step of PASB, prior to the addition of commercial cellulolytic cocktail, significantly enhanced the saccharification process. All these characteristics demonstrate the advantageous application of this enzyme in several biotechnological processes in food and feed industry and also in the enzymatic pretreatment of biomass for feedstock and ethanol production. © 2013 Alvarez et al.
Resumo:
Although many Brazilian sugar mills initiate the fermentation process by inoculating selected commercial Saccharomyces cerevisiae strains, the unsterile conditions of the industrial sugar cane ethanol fermentation process permit the constant entry of native yeast strains. Certain of those native strains are better adapted and tend to predominate over the initial strain, which may cause problems during fermentation. In the industrial fermentation process, yeast cells are often exposed to stressful environmental conditions, including prolonged cell recycling, ethanol toxicity and osmotic, oxidative or temperature stress. Little is known about these S. cerevisiae strains, although recent studies have demonstrated that heterogeneous genome architecture is exhibited by some selected well-adapted Brazilian indigenous yeast strains that display high performance in bioethanol fermentation. In this study, 11 microsatellite markers were used to assess the genetic diversity and population structure of the native autochthonous S. cerevisiae strains in various Brazilian sugar mills. The resulting multilocus data were used to build a similarity-based phenetic tree and to perform a Bayesian population structure analysis. The tree revealed the presence of great genetic diversity among the strains, which were arranged according to the place of origin and the collection year. The population structure analysis revealed genotypic differences among populations; in certain populations, these genotypic differences are combined to yield notably genotypically diverse individuals. The high yeast diversity observed among native S. cerevisiae strains provides new insights on the use of autochthonous high-fitness strains with industrial characteristics as starter cultures at bioethanol plants. © 2013 John Wiley & Sons, Ltd.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Pós-graduação em Ciências Biológicas (Genética) - IBB
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)