995 resultados para Tower Hill Road Site (Gilberts, Ill.)


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Absorption kinetics of solutes given with the subcutaneous administration of fluids is ill-defined. The gamma emitter, technitium pertechnetate, enabled estimates of absorption rate to be estimated independently using two approaches. In the first approach, the counts remaining at the site were estimated by imaging above the subcutaneous administration site, whereas in the second approach, the plasma technetium concentration-time profiles were monitored up to 8 hr after technetium administration. Boluses of technetium pertechnetate were given both intravenously and subcutaneously on separate occasions with a multiple dosing regimen using three doses on each occasion. The disposition of technetium after iv administration was best described by biexponential kinetics with a V-ss of 0.30 +/- 0.11 L/kg and a clearance of 30.0 +/- 13.1 ml/min. The subcutaneous absorption kinetics was best described as a single exponential process with a half-life of 18.16 +/- 3.97 min by image analysis and a half-life of 11.58 +/- 2.48 min using plasma technetium time data. The bioavailability of technetium by the subcutaneous route was estimated to be 0.96 +/- 0.12. The absorption half-life showed no consistent change with the duration of the subcutaneous infusion. The amount remaining at the absorption site with time was similar when analyzed using image analysis, and plasma concentrations assuming multiexponential disposition kinetics and a first-order absorption process. Profiles of fraction remaining at the absorption sire generated by deconvolution analysis, image analysis, and assumption of a constant first-order absorption process were similar. Slowing of absorption from the subcutaneous administration site is apparent after the last bolus dose in three of the subjects and can De associated with the stopping of the infusion. In a fourth subject, the retention of technetium at the subcutaneous site is more consistent with accumulation of technetium near the absorption site as a result of systemic recirculation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: There has been an increase in worldwide infections caused by carbapenem-resistant Acinetobacter. This poses a therapeutic challenge as few treatment options are available. Objectives: The aim of this study was to evaluate the efficacy and safety of polymyxins and ampicillin/sulbactam for treating infections caused by carbapenem-resistant Acinetobacter spp. and to evaluate prognostic factors. Methods: This was a retrospective review of patients from two teaching hospitals who had nosocomial infections caused by carbapenem-resistant Acinetobacter spp. from 1996 to 2004. Diagnosis of infection was based on CDC criteria plus the isolation of Acinetobacter from a usually sterile site or from bronchoalveolar lavage. Urinary tract infections were not included. Data on demographic and clinical features and treatment were collected from medical records. Prognostic factors associated with two outcomes (mortality during treatment and in-hospital mortality) were evaluated. Results: Eighty-two patients received polymyxins and 85 were treated with ampicillin/sulbactam. Multiple logistic regression analysis revealed that independent predictors of mortality during treatment were treatment with polymyxins, higher Acute Physiological and Chronic Health Evaluation II (APACHE II) score, septic shock, delay in starting treatment and renal failure. On multivariate analysis, prognostic factors for in-hospital mortality were older age, septic shock and higher APACHE II score. Conclusions: This is the first study comparing current therapeutic options for infections due to carbapenem-resistant Acinetobacter. The most important finding of the present study is that ampicillin/sulbactam appears to be more efficacious than polymyxins, which was an independent factor associated with mortality during treatment.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Restoration of nerve continuity and effective maintenance of coaptation are considered fundamental principles of end-to-end peripheral nerve repair. OBJECTIVE: To evaluate the influence of the number of stitches on axonal regeneration and collagen production after neurorrhaphy. METHODS: Thirty male Wistar rats were equally divided into 3 groups and were all operated on with the right sciatic nerve exposed. In 2 groups, the nerve was sectioned and repaired by means of 3 (group B) or 6 (group C) epineurium sutures with 100 monofilament nylon. One group (group A) was used as a control. Each animal from groups B and C underwent electrophysiological evaluation with motor action potential recordings before nerve section and again at an 8-week interval after neurorrhaphy. Nerve biopsy specimens were used for histomorphometric assessment of axonal regeneration and quantification of collagen at the repair site. RESULTS: Animals from group C had significantly lower motor action potential conduction velocities compared with control animals (P = .02), and no significant difference was seen between groups B and C. Parameters obtained from morphometric evaluation were not significantly different between these 2 groups. Type I collagen and III collagen in the epineurium were significantly higher in group C than in either the control group (P = .001 and P = .003) or group B (P = .01 and P = .02). No differences were identified for collagen I and III in the endoneurium. CONCLUSION: Using 6 sutures for nerve repair is associated with worse electrophysiological outcomes and higher amounts of type I and III collagen in the epineurium compared with control. Neurorraphy with 6 stitches is also related to a significant increase in epineurium collagen I and III compared with 3-stitch neurorraphy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: The objective of this study is to evaluate blood glucose (BG) control efficacy and safety of 3 insulin protocols in medical intensive care unit (MICU) patients. Methods: This was a multicenter randomized controlled trial involving 167 MICU patients with at least one BG measurement +/- 150 mg/dL and one or more of the following: mechanical ventilation, systemic inflammatory response syndrome, trauma, or burns. The interventions were computer-assisted insulin protocol (CAIP), with insulin infusion maintaining BG between 100 and 130 mg/dL; Leuven protocol, with insulin maintaining BG between 80 and 110 mg/dL; or conventional treatment-subcutaneous insulin if glucose > 150 mg/dL. The main efficacy outcome was the mean of patients` median BG, and the safety outcome was the incidence of hypoglycemia (<= 40 mg/dL). Results: The mean of patients` median BG was 125.0, 127.1, and 158.5 mg/dL for CAIP, Leuven, and conventional treatment, respectively (P = .34, CAIP vs Leuven; P < .001, CAIP vs conventional). In CAIP, 12 patients (21.4%) had at least one episode of hypoglycemia vs 24 (41.4%) in Leuven and 2 (3.8%) in conventional treatment (P = .02, CAIP vs Leuven; P = .006, CAIP vs conventional). Conclusions: The CAIP is safer than and as effective as the standard strict protocol for controlling glucose in MICU patients. Hypoglycemia was rare under conventional treatment. However, BG levels were higher than with IV insulin protocols. (C) 2009 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The use of improved microbiological procedures associated with molecular techniques has increased the identification of Candida bloodstream infections, even if the isolation of more than one species by culture methods remains uncommon. We report the cases of two children presenting with severe gastrointestinal disorders and other risk factors that contribute to Candida infections. In the first patient, C. albicans DNA was initially detected by a nested-amplification and C. tropicalis was found later during hospitalization, while blood cultures were persistently negative. In the second child, there was amplification of C. albicans and C. glabrata DNA in the same samples, but blood cultures yielded only C. albicans. Both patients received antifungal therapy but had unfavorable outcomes. These two cases illustrate that PCR was more successful than culture methods in detecting Candida in the bloodstream of high risk children, and was also able to detect the presence of more than one species in the same patient that might impact therapy when the fungi are resistant to azole compounds.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Structural and inflammatory changes in asthma involve both the large and small airways, with involvement of the distal lung being related to disease severity. We have previously shown that changes in the extracellular matrix (ECM) composition of the distal lung are associated with loss of alveolar attachments in patients with fatal asthma. However, major ECM elements, such as collagen I and fibronectin and their regulators, have not been addressed at the distal level. Objective: We sought to evaluate ECM remodeling in the distal lungs of asthmatic patients. Methods: Using immunohistochemistry and image analysis, we determined the content of collagen I and III, fibronectin, and matrix metalloproteinases; (MMPs) 1, 2, and 9 and tissue inhibitors of metalloproteinase (MMPs) 1 and 2 in the large and small airways and lung parenchyma of 24 patients with fatal asthma and compared the results with those of 11 nonasthmatic control subjects. Protein content was defined as the area of positive staining divided by basement membrane or septum length. Results: We observed increased collagen I and decreased collagen III content in the small airways of asthmatic patients compared with that seen in control subjects. Greater fibronectin and MMP-1, MMP-2, and MMP-9 content was observed at the outer area of the small airways in asthmatic patients. NIMP content was also increased in the peribronchiolar parenchyma in asthmatic patients. In contrast, TIMP expression was only increased in the large airways of asthmatic patients compared with that seen in control subjects. Conclusions: The outer area of the small airways is a major site of ECM remodeling in fatal asthma, potentially contributing to functional changes and the loss of airway-parenchyma interdependence observed in patients with fatal asthma. (J Allergy Clin Immunol 2009;123:1090-7.)

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background. The loss of a child is considered the hardest moment in a parent`s life. Studies addressing length of survival under pediatric palliative care are rare. The aim of this study was to improve a survival prediction model for children in palliative care, as accurate information positively impacts parent and child preparation for palliative care. Procedure. Sixty-five children referred to a pediatric palliative care team were followed from August 2003 until December 2006. Variables investigated (also included in previous studies) were: diagnosis, home care provider, presence of anemia, and performance status score given by the home care provider. Clinical variables such as symptom number were also used to test the score`s ability to pre-validated using the above variables. The number of symptoms at transition to palliative care does not improve the score`s predictive ability. The sum of the single scores gives an overall score for each patient, dividing the population into three groups by probability of 60-day survival: Group A 80.0%, Group B 38.0%, and Group C 28.5% (P < 0.001). Conclusion. A pediatric palliative care score based on easily accessible variables is statistically significant in multivariate analysis. Factors that increase accuracy of life expectancy prediction enable adequate information to be given to patients and families, contributing to therapeutic decision-making issues. Pediatr Blood Cancer. 2010;55:1167-1171. (C) 2010 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: Inorganic apparent strong ion difference (SIDai) improves chloride-associated acidosis recognition in dysnatremic patients. We investigated whether the difference between sodium and chloride (Na+-C1-) or the ratio between chloride and sodium (Cl-/Na+) could be used as SIDai surrogates in mixed and dysnatremic patients. Patients and Methods: Two arterial blood samples were collected from 128 patients. Physicochemical analytical approach was used. Correlation, agreement, accuracy, sensitivity, and specificity were measured to examine whether Na(+)-C1(-) and CI(-)/Na(+) could be used instead of SIDai in the diagnosis of acidosis. Results: Na(+)-C1(-) and CF/Na+ were well correlated with SIDai (R = 0.987, P < 0.001 and R = 0.959, P < 0.001, respectively). Bias between Na(+)-C1(-) and SIDai was high (6.384 with a limit of agreement of 4.4638.305 mEq/L). Accuracy values for the identification of SIDai acidosis (<38.9 mEq/L) were 0.989 (95% confidence interval [CI], 0.980-0.998) for Na+-C1- and 0.974 (95% CI, 0.959-0.989) for Cr/Na+. Receiver operator characteristic curve showed that values revealing SIDai acidosis were less than 32.5 mEq/L for Nata- and more than 0.764 for C17Na+ with sensitivities of 94.0% and 92.0% and specificities of 97.0% and 90.0%, respectively. Nata- was a reliable S IDai surrogate in dysnatremic patients. Conclusions: Nata- and CI-/Na+ are good tools to disclose S IDai acidosis. In patients with dysnatremia, Nata- is an accurate tool to diagnose SIDai acidosis. (C) 2010 Elsevier Inc. All rights reserved.