938 resultados para Test methods


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Purpose: To compare the performance Glaucoma Quality of Life-15 (GQL-15) Questionnaire, intraocular pressure measurement (IOP Goldmann tonometry) and a measure of visual field loss using Moorfields Motion Displacement Test (MDT) in detecting glaucomatous eyes from a self referred population. Methods: The GQL-15 has been suggested to correlate with visual disability and psychophysical measures of visual function in glaucoma patients. The Moorfields MDT is a multi location perimetry test with 32 white line stimuli presented on a grey background on a standard laptop computer. Each stimulus is displaced between computer frames to give the illusion of "apparent motion". Participants (N=312, 90% older than 45 years; 20.5% family history of glaucoma) self referred to an advertised World Glaucoma Day (March 2009) Jules Gonin Eye Hospital, Lausanne Switzerland. Participants underwent a clinical exam (IOP, slit lamp, angle and disc examination by a general ophthalmologist), 90% completed a GQL-15 questionnaire and over 50% completed a MDT test in both eyes. Those who were classified as abnormal on one or more of the following (IOP >21 mmHg/ GQL-15 score >20/ MDT score >2/ clinical exam) underwent a follow up clinical examination by a glaucoma specialist including imaging and threshold perimetry. After the second examination subjects were classified as "healthy"(H), "glaucoma suspect" (GS) (ocular hypertension and/or suspicious disc, angle closure with SD) or "glaucomatous" (G). Results: One hundred and ten subjects completed all 4 initial examinations; of these 69 were referred to complete the 2nd examination and were classified as; 8 G, 24 GS, and 37 H. MDT detected 7/8 G, and 7/24 GS, with false referral rate of 3.8%. IOP detected 2/8 G and 8/24 GS, with false referral rate of 8.9%. GQL-15 detected 4/8 G, 16/24 GS with a false referral rate of 42%. Conclusions: In this sample of participants attending a self referral glaucoma detection event, the MDT performed significantly better than the GQL-15 and IOP in discriminating glaucomatous patients from healthy subjects. Further studies are required to assess the potential of the MDT as a glaucoma screening tool.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

INTRODUCTION: Quantitative sensory testing (QST) is widely used in human research to investigate the integrity of the sensory function in patients with pain of neuropathic origin, or other causes such as low back pain. Reliability of QST has been evaluated on both sides of the face, hands and feet as well as on the trunk (Th3-L3). In order to apply these tests on other body-parts such as the lower lumbar spine, it is important first to establish reliability on healthy individuals. The aim of this study was to investigate intra-rater reliability of thermal QST in healthy adults, on two sites within the L5 dermatome of the lumbar spine and lower extremity. METHODS: Test-retest reliability of thermal QST was determined at the L5-level of the lumbar spine and in the same dermatome on the lower extremity in 30 healthy persons under 40 years of age. Results were analyzed using descriptive statistics and intraclass correlation coefficient (ICC). Values were compared to normative data, using Z-transformation. RESULTS: Mean intraindividual differences were small for cold and warm detection thresholds but larger for pain thresholds. ICC values showed excellent reliability for warm detection and heat pain threshold, good-to-excellent reliability for cold pain threshold and fair-to-excellent reliability for cold detection threshold. ICC had large ranges of confidence interval (95%). CONCLUSION: In healthy adults, thermal QST on the lumbar spine and lower extremity demonstrated fair-to-excellent test-retest reliability.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The concept of early detection to then intervene and improve the prognostic seems straightforward. Applied to asymptomatic subjects, this concept--screening--is rather complex. This review presents the rational and fundamental principles of screening. It underscores the fundamental principles related to the disease and to the screening test considered, the importance of considering screening as a program rather than a test only, and the validity of measures used to evaluate the efficacy of screening. Lastly, it reviews the most frequently bias encountered in screening studies and interpretations.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: The objective is to develop a cost-effective, reliable and non invasive screening test able to detect early CRCs and adenomas. This is done on a nucleic acids multigene assay performed on peripheral blood mononuclear cells (PBMCs). METHODS: A colonoscopy-controlled study was conducted on 179 subjects. 92 subjects (21 CRC, 30 adenoma >1 cm and 41 controls) were used as training set to generate a signature. Other 48 subjects kept blinded (controls, CRC and polyps) were used as a test set. To determine organ and disease specificity 38 subjects were used: 24 with inflammatory bowel disease (IBD),14 with other cancers (OC). Blood samples were taken and PBMCs were purified. After the RNA extraction, multiplex RT-qPCR was applied on 92 different candidate biomarkers. After different univariate and multivariate analysis 60 biomarkers with significant p-values (<0.01) were selected. 2 distinct biomarker signatures are used to separate patients without lesion from those with CRC or with adenoma, named COLOX CRC and COLOX POL. COLOX performances were validated using random resampling method, bootstrap. RESULTS: COLOX CRC and POL tests successfully separate patients without lesions from those with CRC (Se 67%, Sp 93%, AUC 0.87), and from those with adenoma > 1cm (Se 63%, Sp 83%, AUC 0.77). 6/24 patients in the IBD group and 1/14 patients in the OC group have a positive COLOX CRC. CONCLUSION: The two COLOX tests demonstrated a high Se and Sp to detect the presence of CRCs and adenomas > 1 cm. A prospective, multicenter, pivotal study is underway in order to confirm these promising results in a larger cohort.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Question: When multiple observers record the same spatial units of alpine vegetation, how much variation is there in the records and what are the consequences of this variation for monitoring schemes to detect change? Location: One test summit in Switzerland (Alps) and one test summit in Scotland (Cairngorm Mountains). Method: Eight observers used the GLORIA protocols for species composition and visual cover estimates in percent on large summit sections (>100 m2) and species composition and frequency in nested quadrats (1 m2). Results: The multiple records from the same spatial unit for species composition and species cover showed considerable variation in the two countries. Estimates of pseudoturnover of composition and coefficients of variation of cover estimates for vascular plant species in 1m x 1m quadrats showed less variation than in previously published reports whereas our results in larger sections were broadly in line with previous reports. In Scotland, estimates for bryophytes and lichens were more variable than for vascular plants. Conclusions: Statistical power calculations indicated that, unless large numbers of plots were used, changes in cover or frequency were only likely to be detected for abundant species (exceeding 10% cover) or if relative changes were large (50% or more). Lower variation could be reached with the point methods and with larger numbers of small plots. However, as summits often strongly differ from each other, supplementary summits cannot be considered as a way of increasing statistical power without introducing a supplementary component of variance into the analysis and hence the power calculations.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Early detection of neural-tude defects is possible by determining Alpha-fetoprotein (AFP) in maternal serum. 16'685 pregnant women were observed. Three methods for the determination of the "normal" range are compared. The first one, already used in similar studies, makes use of a constant multiple of the median. The other two ones make use of robust estimates of location and scale. Their comparison shows the interest of the robust methods to reduce the interlaboratory variability.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Several methods and algorithms have recently been proposed that allow for the systematic evaluation of simple neuron models from intracellular or extracellular recordings. Models built in this way generate good quantitative predictions of the future activity of neurons under temporally structured current injection. It is, however, difficult to compare the advantages of various models and algorithms since each model is designed for a different set of data. Here, we report about one of the first attempts to establish a benchmark test that permits a systematic comparison of methods and performances in predicting the activity of rat cortical pyramidal neurons. We present early submissions to the benchmark test and discuss implications for the design of future tests and simple neurons models

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Detection rates for adenoma and early colorectal cancer (CRC) are unsatisfactory due to low compliance towards invasive screening procedures such as colonoscopy. There is a large unmet screening need calling for an accurate, non-invasive and cost-effective test to screen for early neoplastic and pre-neoplastic lesions. Our goal is to identify effective biomarker combinations to develop a screening test aimed at detecting precancerous lesions and early CRC stages, based on a multigene assay performed on peripheral blood mononuclear cells (PBMC).Methods: A pilot study was conducted on 92 subjects. Colonoscopy revealed 21 CRC, 30 adenomas larger than 1 cm and 41 healthy controls. A panel of 103 biomarkers was selected by two approaches: a candidate gene approach based on literature review and whole transcriptome analysis of a subset of this cohort by Illumina TAG profiling. Blood samples were taken from each patient and PBMC purified. Total RNA was extracted and the 103 biomarkers were tested by multiplex RT-qPCR on the cohort. Different univariate and multivariate statistical methods were applied on the PCR data and 60 biomarkers, with significant p-value (< 0.01) for most of the methods, were selected.Results: The 60 biomarkers are involved in several different biological functions, such as cell adhesion, cell motility, cell signaling, cell proliferation, development and cancer. Two distinct molecular signatures derived from the biomarker combinations were established based on penalized logistic regression to separate patients without lesion from those with CRC or adenoma. These signatures were validated using bootstrapping method, leading to a separation of patients without lesion from those with CRC (Se 67%, Sp 93%, AUC 0.87) and from those with adenoma larger than 1cm (Se 63%, Sp 83%, AUC 0.77). In addition, the organ and disease specificity of these signatures was confirmed by means of patients with other cancer types and inflammatory bowel diseases.Conclusions: The two defined biomarker combinations effectively detect the presence of CRC and adenomas larger than 1 cm with high sensitivity and specificity. A prospective, multicentric, pivotal study is underway in order to validate these results in a larger cohort.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

OBJECTIVE: Accuracy studies of Patient Safety Indicators (PSIs) are critical but limited by the large samples required due to low occurrence of most events. We tested a sampling design based on test results (verification-biased sampling [VBS]) that minimizes the number of subjects to be verified. METHODS: We considered 3 real PSIs, whose rates were calculated using 3 years of discharge data from a university hospital and a hypothetical screen of very rare events. Sample size estimates, based on the expected sensitivity and precision, were compared across 4 study designs: random and VBS, with and without constraints on the size of the population to be screened. RESULTS: Over sensitivities ranging from 0.3 to 0.7 and PSI prevalence levels ranging from 0.02 to 0.2, the optimal VBS strategy makes it possible to reduce sample size by up to 60% in comparison with simple random sampling. For PSI prevalence levels below 1%, the minimal sample size required was still over 5000. CONCLUSIONS: Verification-biased sampling permits substantial savings in the required sample size for PSI validation studies. However, sample sizes still need to be very large for many of the rarer PSIs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A program of A (90 day moist room), B (14 day moist room) and C (7 day moist room and 7 day 50%_humidity) type curing for the R-11-Z program of durability of concrete using the automatic freeze and thaw machine (ASTM C-291) has been used in the Materials Department of the Iowa State Highway Commission since December 6, 1966. A summary of the results obtained from then until March 25, 1968, indicates that the B and C type curing are yielding very little valuable information. However, the A cure exhibits a wide range of durability factors and also groups the aggregates in an order which is related to the service record (there are definite exceptions. The biggest disadvantage to the A cure is the length of time that it takes to complete the test (90 day cure and 38 day test). The Kansas Highway Department has experimented with different cements and aggregates in order to determine which combination offers a concrete with the best durability factor possible. In an experimental test section of highway, concrete made with a Type II cement appeared to have better durability than others made with Type I cements. Because of this, a question has been raised at the Iowa State Highway Commission - Can concrete made with Type II cements, because of a lesser amount of tricalcium aluminate, yield better durability than concrete made with Type I cements?

Relevância:

30.00% 30.00%

Publicador:

Resumo:

There has been relatively little change over recent decades in the methods used in research on self-reported delinquency. Face-to-face interviews and selfadministered interviews in the classroom are still the predominant alternatives envisaged. New methods have been brought into the picture by recent computer technology, the Internet, and an increasing availability of computer equipment and Internet access in schools. In the autumn of 2004, a controlled experiment was conducted with 1,203 students in Lausanne (Switzerland), where "paper-and-pencil" questionnaires were compared with computer-assisted interviews through the Internet. The experiment included a test of two different definitions of the (same) reference period. After the introductory question ("Did you ever..."), students were asked how many times they had done it (or experienced it), if ever, "over the last 12 months" or "since the October 2003 vacation". Few significant differences were found between the results obtained by the two methods and for the two definitions of the reference period, in the answers concerning victimisation, self-reported delinquency, drug use, failure to respond (missing data). Students were found to be more motivated to respond through the Internet, take less time for filling out the questionnaire, and were apparently more confident of privacy, while the school principals were less reluctant to allow classes to be interviewed through the Internet. The Internet method also involves considerable cost reductions, which is a critical advantage if self-reported delinquency surveys are to become a routinely applied method of evaluation, particularly so in countries with limited resources. On balance, the Internet may be instrumental in making research on self-reported delinquency far more feasible in situations where limited resources so far have prevented its implementation.