995 resultados para SUPERNUMERARY CHROMOSOMES


Relevância:

10.00% 10.00%

Publicador:

Resumo:

L-2-hydroxyglutaric aciduria (L-2-HGA, MIM 236792) is a neurometabolic disorder caused by the toxic accumulation of high concentration of L-2-hydroxyglutaric acid in plasma and cerebrospinal fluid. Distinct mutations on the L2HGDH gene have been associated with the clinical and biochemical phenotype. Here we present three novel mutations (Gln197X, Gly211Val and c.540+1 G>A), which increase the present deleterious collection of L2HGDH gene up to 35 mutations that we have compiled in this study. In addition, we used the haplotypic information based on polymorphic markers to demonstrate the common origin of Gly57Arg harboring chromosomes. Journal of Human Genetics (2010) 55, 55-58; doi: 10.1038/jhg.2009.110; published online 13 November 2009

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The term disorders of sex development (DSD) includes congenital conditions in which development of chromosomal, gonadal or anatomical sex is atypical. Mutations in genes present in X, Y or autosomal chromosomes can cause abnormalities of testis determination or disorders of sex differentiation leading to 46,XY DSD. Detailed clinical phenotypes allow the identification of new factors that can alter the expression or function of mutated proteins helping to understand new undisclosed biochemical pathways. In this review we present an update on 46,XY DSD aetiology, diagnosis and treatment based on extensive review of the literature and our three decades of experience with these patients.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Lentil is a self-pollinating diploid (2n = 14 chromosomes) annual cool season legume crop that is produced throughout the world and is highly valued as a high protein food. Several abiotic stresses are important to lentil yields world wide and include drought, heat, salt susceptibility and iron deficiency. The biotic stresses are numerous and include: susceptibility to Ascochyta blight, caused by Ascochyta lentis; Anthracnose, caused by Colletotrichum truncatum; Fusarium wilt, caused by Fusarium oxysporum; Sclerotinia white mold, caused by Sclerotinia sclerotiorum; rust, caused by Uromyces fabae; and numerous aphid transmitted viruses. Lentil is also highly susceptible to several species of Orabanche prevalent in the Mediterranean region, for which there does not appear to be much resistance in the germplasm. Plant breeders and geneticists have addressed these stresses by identifying resistant/tolerant germplasm, determining the genetics involved and the genetic map positions of the resistant genes. To this end progress has been made in mapping the lentil genome and several genetic maps are available that eventually will lead to the development of a consensus map for lentil. Marker density has been limited in the published genetic maps and there is a distinct lack of co-dominant markers that would facilitate comparisons of the available genetic maps and efficient identification of markers closely linked to genes of interest. Molecular breeding of lentil for disease resistance genes using marker assisted selection, particularly for resistance to Ascochyta blight and Anthracnose, is underway in Australia and Canada and promising results have been obtained. Comparative genomics and synteny analyses with closely related legumes promises to further advance the knowledge of the lentil genome and provide lentil breeders with additional genes and selectable markers for use in marker assisted selection. Genomic tools such as macro and micro arrays, reverse genetics and genetic transformation are emerging technologies that may eventually be available for use in lentil crop improvement.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background/Aims: Approximately four million Africans were taken as slaves to Brazil, where they interbred extensively with Amerindians and Europeans. We have previously shown that while most White Brazilians carry Y chromosomes of European origin, they display high proportions of African and Amerindian mtDNA lineages, because of sex-biased genetic admixture. Methods: We studied the Y chromosome and mtDNA haplogroup structure of 120 Black males from Sao Paulo, Brazil. Results: Only 48% of the Y chromosomes, but 85% of the mtDNA haplogroups were characteristic of sub-Saharan Africa, confirming our previous observation of sexually biased mating. We mined literature data for mtDNA and Y chromosome haplogroup frequencies for African native populations from regions involved in Atlantic Slave Trade. Principal Components Analysis and Bayesian analysis of population structure revealed no genetic differentiation of Y chromosome marker frequencies between the African regions. However, mtDNA examination unraveled considerable genetic structure, with three clusters at Central-West Africa, West Africa and Southeast Africa. A hypothesis is proposed to explain this structure. Conclusion: Using these mtDNA data we could obtain for the first time an estimate of the relative ancestral contribution of Central-West (0.445), West (0.431) and Southeast Africa (0.123) to African Brazilians from Sao Paulo. These estimates are consistent with historical information. Copyright (c) 2008 S. Karger AG, Basel.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Familial Mediterranean fever (FMF) is a recessive disorder of inflammation caused by mutations in a gene (designated MEFV) on chromosome 16p13.3, We have recently constructed a 1-Mb cosmid contig that includes the FMF critical region. Here we show genotype data for 12 markers from our physical map, including 5 newly identified microsatellites, in FMF families. Intrafamilial recombinations placed MEFV in the similar to 285 kb between D16S468/D16S3070 and D16S3376. We observed significant linkage disequilibrium in the North African Jewish population, and historical recombinants in the founder haplotype placed MEFV between D16S3082 and D16S3373 (similar to 200 kb). In smaller panels of Iraqi Jewish, Arab, and Armenian families, there were significant allelic associations only for D16S3370 and D16S2617 among the Armenians. A sizable minority of Iraqi Jewish and Armenian carrier chromosomes appeared to be derived from the North African Jewish ancestral haplotype. We observed a unique FMF haplotype common to Iraqi Jews, Arabs, and Armenians and two other haplotypes restricted to either the Iraqi Jewish or the Armenian population. These data support the view that a few major mutations account for a large percentage of the cases of FMF and suggest that same of these mutations arose before the affected Middle Eastern populations diverged from one another. (C) 1997 Academic Press.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Oligodendrogliomas are the second most common malignant brain tumor in adults and exhibit characteristic losses of chromosomes 1p and 19q. To identify the molecular genetic basis for this alteration, we performed exomic sequencing of seven tumors. Among other changes, we found that the CIC gene (homolog of the Drosophila gene capicua) on chromosome 19q was somatically mutated in six cases and that the FUBP1 gene [encoding far-upstream element (FUSE) binding protein] on chromosome 1p was somatically mutated in two tumors. Examination of 27 additional oligodendrogliomas revealed 12 and 3 more tumors with mutations of CIC and FUBP1, respectively, 58% of which were predicted to result in truncations of the encoded proteins. These results suggest a critical role for these genes in the biology and pathology of oligodendrocytes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objective: To compare cryopreservation of mature human oocytes with slow-rate freezing and vitrification and determine which is most efficient at establishing a pregnancy. Design: Prospective randomized. Setting: Academically affiliated, private fertility center. Patient(s): Consenting patients with concerns about embryo cryopreservation and more than nine mature oocytes at retrieval were randomized to slow-rate freezing or vitrification of supernumerary (more than nine) oocytes. Intervention(s): Oocytes were frozen or vitrified, and upon request oocytes were thawed or warmed, respectively. Main Outcome Measure(s): Oocyte survival, fertilization, embryo development, and clinical pregnancy. Result(s): Patient use has resulted in 30 thaws and 48 warmings. Women`s age at time of cryopreservation was similar. Oocyte survival was significantly higher following vitrification/warming (81%) compared with freezing/thawing (67%). Fertilization was more successful in oocytes vitrified/warmed compared with frozen/thawed. Fertilized oocytes from vitrification/warming had significantly better cleavage rates (84%) compared with freezing/thawing (71%) and resulted in embryos with significantly better morphology. Although similar numbers of embryos were transferred, embryos resulting from vitrified oocytes had significantly enhanced clinical (38%) pregnancy rates compared with embryos resulting from frozen oocyte (13%). Miscarriage and/or spontaneous abortion rates were similar. Conclusion(s): Our results suggest that vitrification/warming is currently the most efficient means of oocyte cryopreservation in relation to subsequent success in establishing pregnancy. (Fertil Steril (R) 2010; 94: 2088-95. (C) 2010 by American Society for Reproductive Medicine.)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Well-differentiated liposarcoma (WDLS) is one of the most common malignant mesenchymal tumors and dedifferentiated liposarcoma (DDLS) is a malignant tumor consisting of both WDLS and a transformed nonlipogenic sarcomatous component. Cytogenetically, WDLS is characterized by the presence of ring or giant rod chromosomes containing several amplified genes, including MDM2, TSPAN31 CDK4, and others mainly derived from chromosome bands 12q13-15. However, the 12q13-15 amplicon is large and discontinuous. The focus of this study was to identify novel critical genes that are consistently amplified in primary (nonrecurrent) WDLS and with potential relevance for future targeted therapy. Using a high-resolution (5.0 kb) ""single nucleotide polymorphism""/copy number variation microarray to screen the whole genome in a series of primary WDLS, two consistently amplified areas were found on chromosome 12: one region containing the MDM2 and CPM genes, and another region containing the FRS2 gene. Based on these findings, we further validated FRS2 amplification in both WDLS and DDLS. Fluorescence in situ hybridization confirmed FRS2 amplification in all WDLS and DDLS tested (n = 57). Real time PCR showed FRS2 mRNA transcriptional upregulation in WDLS (n = 19) and DDLS (n = 13) but not in lipoma (n = 5) and normal fat (n = 9). Immunoblotting revealed high expression levels of phospho-FRS2 at 1436 and slightly overexpression of total FRS2 protein in liposarcoma but not in normal fat or preadipocytes. Considering the critical role of FRS2 in mediating fibroblast growth factor receptor signaling, our findings indicate that FRS2 signaling should be further investigated as a potential therapeutic target for liposarcoma. (C) 2011 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Deletion of the long arm of chromosome 18 is one of the most common segmental aneusomies compatible with life and usually involves a deletion of the terminal chromosomal region. However, the mechanisms implicated in the stabilization of terminal deletions are not well understood. In this study, we analyzed a girl with moderate mental retardation who had a cytogenetically visible terminal 18q deletion. In order to characterize the breakpoint in the terminal 18q region, we used fluorescence In situ hybridization (FISH) with bacterial artificial chromosomes (BACs) and pan-telomeric probes and also the array technique based on comparative genomic hybridization (array-CGH). FISH with pan-telomeric probes revealed no signal in the terminal region of the deleted chromosome, indicating the absence of normal telomere repeat (TTAGGG)n sequences in 18q. We suggest that neo-telomere formation by chromosome healing was involved in the repair and stabilization of this terminal deletion. (C) 2010 Elsevier Masson SAS. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Rearrangements of 1p36 are the most frequently detected abnormalities in diagnostic testing for chromosomal cryptic imbalances and include variably sized simple terminal deletions, derivative chromosomes, interstitial deletions, and complex rearrangements. These rearrangements result in the specific pattern of malformation and neurodevelopmental disabilities that characterizes monosomy 1p36 syndrome. Thus far, no individual gene within this region has been conclusively determined to be causative of any component of the phenotype. Nor is it known if the rearrangements convey phenotypes via a haploinsufficiency mechanism or through a position effect. We have used multiplex ligation-dependent probe amplification to screen for deletions of 1p36 in a group of 154 hyperphagic and overweight/obese, PWS negative individuals, and in a separate group of 83 patients initially sent to investigate a variety of other conditions. The strategy allowed the identification and delineation of rearrangements in nine subjects with a wide spectrum of clinical presentations. Our work reinforces the association of monosomy 1p36 and obesity and hyperphagia, and further suggests that these features may be associated with non-classical manifestations of this disorder in addition to a submicroscopic deletion of similar to 2-3 Mb in size. Multiplex ligation probe amplification using the monosomy 1p36 syndrome-specific kit coupled to the subtelomeric kit is an effective approach to identify and delineate rearrangements at 1p36. (C) 2009 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Adipose tissue tumors of the retroperitoneum showing no identifiable cytologic atypia are usually classified as lipoma-like well-differentiated liposarcoma. Whether a subset of these tumors represents true examples of retroperitoneal lipoma remains a controversial subject, because the diagnostic liposarcoma cells may be of difficult identification, even after extensive sampling. Herein, we describe a large retroperitoneal lipoma with classic histopathologic, cytogenetic, molecular cytogenetic, and molecular genetic features. Extensive morphologic inspection showed no evidence of cytologic atypia. Cytogenetic analysis performed on fresh tissue material revealed the classic lipoma chromosome t(3;12)(q27;q14-15). Fluorescence in situ hybridization on multiple sections excluded the presence of MDM2 and CDK4 amplification, but showed HMGA2 balanced rearrangement in most cells. Reverse-transcriptase polymerase chain reaction followed by sequencing analysis confirmed the presence of the HMGA2-LPP fusion gene, a characteristic and the most common fusion product found in lipoma. The patient has been followed for 2.5 years without evidence of recurrence or metastasis. These results indicate that retroperitoneal lipomata do exist, but their diagnosis must rely on stringent histologic, cytogenetic, and molecular genetic analysis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In the present study, the molecular karyotypes of 12 KP1(+) and KP1(-) Trypanosoma rangeli strains were determined and 10 different molecular markers were hybridized to the chromosomes of the parasite, including seven obtained from T. rangeli [ubiquitin hydrolase (UH), a predicted serine/threonine protein kinase (STK), hexose transporter, hypothetical protein, three anonymous sequences] and three from Trypanosoma cruzi [ubiquitin-conjugating enzyme E2 (UBE2), ribosomal RNA methyltransferase (rRNAmtr), proteasome non-ATPase regulatory subunit 6 (PSMD6)]. Despite intraspecific variation, analysis of the karyotype profiles permitted the division of the T rangeli strains into two groups coinciding with the KP1(+) and KP1(-) genotypes. Southern blot hybridization showed that, except for the hexose transporter probe, all other probes produced distinct patterns able to differentiate the KP1(+) and KP1(-) genotypes. The UH, STK and An-1A04 probes exclusively hybridized to the chromosomes of KP1(+) strains and can be used as markers of this group. In addition, the UBE2, rRNAmtr and PSMD6 markers, which are present in a conserved region in all trypanosomatid species sequenced so far, co-hybridized to the same T. rangeli chromosomal bands, suggesting the occurrence of gene synteny in these species. The finding of distinct molecular karyotypes in KP1(+) and KP1 (-) strains of T rangeli is noteworthy and might be used as a new approach to the study of genetic variability in this parasite. Together with the Southern blot hybridization results, these findings demonstrate that differences at the kDNA level might be associated with variations in nuclear DNA. (c) 2009 Elsevier BY. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Gene amplification occurs in Bradysia hygida salivary glands, at the end of the fourth larval instar. The hormone 20-hydroxyecdysone (20E) triggers this process, which results in DNA puff formation. Amplified genes are activated in two distinct groups. The activity of the first group is dependent on high levels of 20E, while the second group needs low hormone levels. Consequently, the salivary glands of B. hygida constitute an interesting biological model to study how 20E, and its receptors, affect gene amplification and activity. We produced polyclonal antibodies against B. hygida EcR (BhEcR). In western blots a polypeptide of about 66 kDa was detected in salivary gland extracts. The antibodies were also used for indirect immune-localization of BhEcR in polytene chromosomes. RNA-polymerase II was also immune-detected. We did not detect the receptor in chromosome C where the first and second groups of DNA puffs form during DNA puff anlage formation, but it was present during puff expansion. During the active phase of both groups of DNA puffs, RNA polymerase II co-localized with BhEcR. After puff regression, these antigens were not detected. Apparently, EcR plays a direct role in the transcription of amplified genes, but its role in gene amplification remains enigmatic.