879 resultados para Pulsed dielectric barrier discharge
Resumo:
The objective of this thesis was to study the effect of pulsed electric field on the preparation of TiO2 nanoparticles via sol-gel method. The literature part deals with properties of different TiO2 crystal forms, principles of photocatalysis, sol-gel method and pulsed electric field processing. It was expected that the pulsed electric field would have an influence on crystallite size, specific surface area, polymorphism and photocatalytic activity of produced particles. TiO2 samples were prepared by using different frequencies and treatment times of pulsed electric field. The properties of produced TiO2 particles were examined X-ray diffraction (XRD), Raman spectroscopy and BET surface area analysis. The photocatalytic activities of produced TiO2 particles were determined by using them as photocatalysts for the degradation of formic acid under UVA-light. The photocatalytic activities of samples produced with sol-gel method were also compared with the commercial TiO2 powder Aeroxide® (Evonic Degussa GmbH). Pulsed electric field did not have an effect on the morphology of particles. Results from XRD and Raman analysis showed that all produced TiO2 samples were pure anatase. However, pulsed electric field did have an effect on crystallite size, specific surface area and photocatalytic activity of TiO2 particles. Generally, the crystallite sizes were smaller, specific surface areas larger and initial formic acid degradation rates higher for samples that were produced by applying the pulsed electric field. The higher photocatalytic activities were attributed to larger surface areas and smaller crystallite sizes. Though, with all of the TiO2 samples produced by the sol-gel method the initial formic acid degradation rates were significantly slower than with the commercial TiO2 powder.
Resumo:
The growing pharmaceutical interest, among others, in the polymorphic composition of the emerging solid end-products from production processes has been traced to the need for attainment of high product purity. This is more so as the presence of different polymorphs may constitute physical impurity of the product. Hence, the need for optimization of the yield of desired product component(s) through controlled crystallization kinetics for instance. This study was carried out to investigate the impact of pulsed electric field (PEF) irradiation on the crystal morphology of glycine obtained by cooling crystallization (without seeding) from commercial glycine sample in distilled deionized water solution. In doing so, three different pulse frequencies (294, 950 and 145 Hz) and a case without PEF were studied at three cooling rates (5, 10 and 20 ºC/h). The crystal products obtained were analyzed for polymorphic composition by powder x-ray diffraction (PXRD) and Fourier transform infrared (FTIR) spectroscopy while the particles characterization was done on Morphologi G3. The results obtained from this study showed that pulsed electric field irradiation had significant impact on metastability of the aqueous solution as well as on the polymorphic composition of the end product. With increasing PEF frequency applied, nucleation started earlier and the γ-glycine polymorph content of the product crystals increased. These were found to have been aided by cooling rate, as the most significant effect was observed at 5 ºC/h. It was also discovered that PEF application had no measurable impact on the pH of the aqueous solution as well as the size distribution of the particles. Cooling on the contrary was believed to be responsible for the broadening of the particle size distribution with a downward shift of the lower limit of the raw material from about 100 μm to between 10 and 50 μm.
Resumo:
Tutkimuksen tarkoituksena oli kartoittaa lämpötilan vaikutusta veden orgaanisten haitta-aineiden hapetuksessa PCD-menetelmällä. Kokeita tehtiin näytteiden eri alkulämpötiloilla. Malliyhdisteenä kokeissa käytettiin oksaalihappoa. Teoriaosuudessa käsiteltiin pulssittaista koronapurkausta ilmiönä. Lisäksi tarkasteltiin, kuinka PCD-menetelmällä muodostuu hapettimia neste-kaasufaasissa. Syntyvistä hapettimista keskityttiin otsoniin ja hydroksyyliradikaaliin. Kokeellisessa osuudessa esiteltiin käytetty PCD-laitteisto. Esittelyn jälkeen siirryttiin hapetuskokeiden kuvaamiseen ja analyysin suorittamiseen titrauksella. Lopuksi koottiin tulokset. Tutkimuksissa prosessin hapetustehon havaittiin heikentyvän lämpötilan noustessa tutkitulla lämpötila-alueella, mikä voi selittyä kaasufaasissa muodostuvan otsonin heikentyvällä liukoisuudella. Tuloksia voidaan pitää viitteellisinä, ja selkeän mallin muodostamiseksi tarvitaan jatkotutkimuksia laajemmalla lämpötila-alueella tarkasti toistettavilla koejärjestelyillä.
Resumo:
Neuron-specific enolase (NSE) is a glycolytic enzyme present almost exclusively in neurons and neuroendocrine cells. NSE levels in cerebrospinal fluid (CSF) are assumed to be useful to estimate neuronal injury and clinical outcome of patients with serious clinical manifestations such as those observed in stroke, head injury, anoxic encephalopathy, encephalitis, brain metastasis, and status epilepticus. We compared levels of NSE in serum (sNSE) and in CSF (cNSE) among four groups: patients with meningitis (N = 11), patients with encephalic injuries associated with impairment of consciousness (ENC, N = 7), patients with neurocysticercosis (N = 25), and normal subjects (N = 8). Albumin was determined in serum and CSF samples, and the albumin quotient was used to estimate blood-brain barrier permeability. The Glasgow Coma Scale score was calculated at the time of lumbar puncture and the Glasgow Outcome Scale (GOS) score was calculated at the time of patient discharge or death. The ENC group had significantly higher cNSE (P = 0.01) and albumin quotient (P = 0.005), but not sNSE (P = 0.14), levels than the other groups (Kruskal-Wallis test). Patients with lower GOS scores had higher cNSE levels (P = 0.035) than patients with favorable outcomes. Our findings indicate that sNSE is not sensitive enough to detect neuronal damage, but cNSE seems to be reliable for assessing patients with considerable neurological insult and cases with adverse outcome. However, one should be cautious about estimating the severity of neurological status as well as outcome based exclusively on cNSE in a single patient.
Resumo:
Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.
Resumo:
The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.
Resumo:
The objective of this thesis was to study the effect of pulsed electric field on the preparation of TiO2 nanoparticles via sol-gel method under the visible light irradiation. The literature part introduces properties of different TiO2 crystal forms and principle of photocatalysis. It was expected that pulsed electric field would have an influence on degradation for oxalic acid and formic acid. TiO2 samples were prepared by using three frequencies (50Hz, 294Hz, and 963Hz) and two treatment times (12 minutes and 24 minutes) of pulsed electric field. The photocatalytic activities of TiO2 samples produced with sol-gel method were also compared with the TiO2 particles made by previous study and with the commercial TiO2 powder Aeroxide® (Evonic Degussa GmbH) at the same condition. Results show that pulsed electric field does have an effect on degradation for oxalic acid and formic acid. Generally, higher photocatalytic activities for oxalic acid and formic acid were obtained with lower frequency and longer treatment time of pulsed electric field.
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
We studied the effect of pulsed ultrasound therapy (UST) and antibothropic polyvalent antivenom (PAV) on the regeneration of mouse extensor digitorum longus muscle following damage by Bothrops jararacussu venom. Animals (Swiss male and female mice weighing 25.0 ± 5.0 g; 5 animals per group) received a perimuscular injection of venom (1 mg/kg) and treatment with UST was started 1 h later (1 min/day, 3 MHz, 0.3 W/cm², pulsed mode). Three and 28 days after injection, muscles were dissected and processed for light microscopy. The venom caused complete degeneration of muscle fibers. UST alone and combined with PAV (1.0 mL/kg) partially protected these fibers, whereas muscles receiving no treatment showed disorganized fascicules and fibers with reduced diameter. Treatment with UST and PAV decreased the effects of the venom on creatine kinase content and motor activity (approximately 75 and 48%, respectively). Sonication of the venom solution immediately before application decreased the in vivo and ex vivo myotoxic activities (approximately 60 and 50%, respectively). The present data show that UST counteracts some effects of B. jararacussu venom, causing structural and functional improvement of the regenerated muscle after venom injury.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
The purpose of this study is to investigate whether commercial Kraft lignin can be treated with pulsed corona discharge apparatus so that it becomes active. Active lignin refers to the kind of lignin that can be precipitated on the surface of a fiber by lowering the pH. A secondary agenda here is to remove the pungent smell of kraft lignin, which is caused by organically bound sulfur. It is expected that the study will identify mild processing conditions and parameters for achievement of the desired outcome. In the literature review, the properties of lignin are explained, as is their impact on any further processing. In addition, a number of processes are described for the oxidation of lignin in a variety of applications. In the experimental part of the study, test runs were conducted to determine the effects of oxygen supply and pulse frequency on oxidation results, where the purpose is to produce reactive lignin and to find a process that is feasible at an industrial scale. Based on the reported experiments, lignin could not be made active or precipitated to the surface of the fiber. Actual changes in the structure of lignin were not observed, but the pungent smell of lignin was removed. The exact reason for this change could not be established because sulfur NMR analysis did not work for the lignin samples.
Resumo:
The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.
Resumo:
Hemicelluloses are potential raw material for several items produced in future wood-based biorefineries. One possible method for recovering hemicelluloses from wood extracts is ultrafiltration (UF). However, low filtration capacities and severe fouling restrict the use of tight UF membranes in the treatment of wood extracts. The lack of suitable commercial membranes creates a need for pretreatment which would decrease fouling and increase the filtration capacity. This thesis focuses on the evaluation of the possibility to improve the filtration capacity and decrease fouling with the pretreatment of wood extracts. Methods which remove harmful compounds and methods which degrade them are studied, as well as combinations of the methods. The tested pretreatments have an influence on both the concentration of different compounds and the molecular mass distribution of the compounds in the extract. This study revealed that in addition to which kind of compounds were removed, also the change in molecular size distribution affected the filtration capacity significantly. It was shown that the most harmful compounds for the filtration capacity of the hydrophobic 5 kDa membrane were the ones capable of permeating the membrane and fouling also the inner membrane structure. Naturally, the size of the most harmful compounds depends on the used UF membrane and is thus case-specific. However, in the choice of the pretreatment method, the focus should be on the removal of harmful compound sizes rather than merely on the total amount of removed foulants. The results proved that filtration capacity can be increased with both adsorptive and oxidative pretreatments even by hundreds of per cents. For instance, the use of XAD7 and XAD16 adsorbents increased the average flux in the UF of a birch extract from nearly zero to 107 kg/(m2h) and 175 kg/(m2h), respectively. In the treatment of a spruce extract, oxidation by pulsed corona discharge (PCD) increased the flux in UF from 46 kg/(m2h) to 158 kg/(m2h). Moreover, when a birch extract batch was treated with laccase enzyme, the flux in UF increased from 15 kg/(m2h) to 36 kg/(m2h). However, fouling was decreased only by adsorptive pretreatment while oxidative methods had a negligible or even negative impact on it. This demonstrates that filtration capacity and fouling are affected by different compounds and mechanisms. The results of this thesis show that filtration capacity can be improved and fouling decreased through appropriate pretreatment. However, the choice of the best possible pretreatment is case-specific and depends on the wood extract and the membrane used. Finding the best option requires information on the extract content and membrane characteristics as well as on the filtration performance of the membrane in the prevailing conditions and a multivariate approach. On the basis of this study, it can be roughly concluded that adsorptive pretreatment improves the filtration capacity and decreases fouling rather reliably, but it may lead to significant hemicellulose losses. Oxidation reduces the loss of valuable hemicelluloses and could improve the filtration capacity, but fouling challenges may remain. Combining oxidation with adsorptive pretreatment was not a solution for avoiding hemicellulose losses in the tested cases.