980 resultados para Property P


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Spermatozoa of most crustacean species are nonmotile and are packed into spermatophores. In Decapoda, spermatophores are highly variable in morphology and can be useful in the solving of taxonomic and systematic questions, especially among the Anomura. In this study, the morphology and morphometry of the spermatophores of the western Atlantic hermit crabs Pagurus brevidactylus and P criniticornis are described. The abdomen of fresh male specimens was dissected to expose the reproductive system and to extract the spermatophores, which were analyzed by stereoscopic, light, and scanning electron microscopy. The vas deferens can be divided macroscopically in three regions, all of them containing spermatophores. Tripartite spermatophores are composed of an elongated cylindrical main ampulla, a triangular accessory ampulla, a narrow cylindrical peduncle, and a round pedestal. Dimensions of the spermatophore components are positively correlated to the size of the crab. Morphological patterns observed in this study resemble those of other pagurid hermit crabs investigated to date. The morphological character distribution confirms classifications based on adult morphology and molecular analysis. J. Morphol. 272:1271-1280, 2011. (C) 2011 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper describes the construction of Australia-wide soil property predictions from a compiled national soils point database. Those properties considered include pH, organic carbon, total phosphorus, total nitrogen, thickness. texture, and clay content. Many of these soil properties are used directly in environmental process modelling including global climate change models. Models are constructed at the 250-m resolution using decision trees. These relate the soil property to the environment through a suite of environmental predictors at the locations where measurements are observed. These models are then used to extend predictions to the continental extent by applying the rules derived to the exhaustively available environmental predictors. The methodology and performance is described in detail for pH and summarized for other properties. Environmental variables are found to be important predictors, even at the 250-m resolution at which they are available here as they can describe the broad changes in soil property.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Teen Triple P is a multilevel system of intervention that is designed to provide parents with specific strategies to promote the positive development of their teenage children as they make the transition into high school and through puberty. The program is based on a combination of education about the developmental needs of adolescents, skills training to improve communication and problem-solving, plus specific modules to deal with common problems encountered by parents and adolescents that can escalate into major conflict and violence. It is designed to increase the engagement of parents of adolescent and pre-adolescent children by providing them with easy access to evidencebased parenting advice and support. This paper presents data collected as part of a survey of over 1400 students in first year high school at 9 Brisbane schools. The survey instrument was constructed to obtain students' reports about behaviour which is known to be associated with their health and wellbeing, and also on the extent to which their parents promoted or discouraged such behaviour at home, at school, and in their social and recreational activities in the wider community. Selected data from the survey were extracted and presented to parents at a series of parenting seminars held at the schools to promote appropriate parenting of teenagers. The objectives were to provide parents with accurate data about teenagers' behaviour, and about teenagers' reports of how they perceived their parents' behaviour. Normative data on parent and teenager behaviour will be presented from the survey as well as psychometric data relating to the reliability and validity of this new measure. Implications of this strategy for increasing parent engagement in parenting programs that aim to reduce behavioural and emotional problems in adolescents will be discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Substance P (SP) is a neuropeptide that can modulate inflammatory mediator release through activation of NK(1) receptors (NK(1)R). Some studies have also suggested the involvement of SP in lipopolysaccharide (LPS)-induced fever. However, the precise contribution of this neuropeptide to the pathways activated during fever is unknown. In this study we investigated the effect of a selective NK(1)R antagonist, SR140333B, on the febrile response induced by LPS and cytokines. Our results show that the systemic injection of SR140333B did not modify the fever induced by LPS at a dose that is able to reduce protein extravasation induced by SP in the skin. On the other hand, intracerebroventricular administration of 5R140333B significantly reduced the fever induced by peripheral injection of LPS. These data emphasize an important role for SP in the central nervous system during the febrile response to LPS, and are reinforced by the fact that intracerebroventricular injection of SP also induced fever in a dose-dependent manner in captopril-treated rats. Considering that the febrile response can result from the generation of several endogenous pyrogens, among them interleukin (IL)-1 beta and macrophage inflammatory protein-1 alpha (CCL3/MIP-1 alpha), we also examined the effect of SR140333B on the fever induced by these cytokines which act through prostaglandin-dependent and independent mechanisms, respectively. Surprisingly, SR140333B did not modify the febrile response to IL-1 beta or CCL3/MIP-1 alpha. Altogether these data suggest that the central action of SP is essential for LPS-, but not for IL-1 beta- or CCL3/MIP-1 alpha-induced fever. (C) 2011 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper examines the syntax of indirect objects (IO) in Brazilian Portuguese (BP). Adopting a comparative perspective we propose that BP differs from European Portuguese (EP) in the grammatical encoding of IO. In EP ditransitive contexts, IO is found in two configurations - one projected by a (low) applicative head and another one involving a lexical/true preposition. We propose that the former property is contingent upon the presence of dative Case marking: namely, the morpheme `a` that introduces IO (a-DP), whose corresponding clitic pronoun is `lhe/lhes`. In contrast, important changes in the pronominal system, coupled with the increase in the use of the preposition `para` are taken as evidence for the loss of the low applicative construction in BP. Thus only the configuration with the lexical/true preposition is found in (Standard) BP. We argue that the innovative properties of IO in BP are due to the loss of the (3rd person) dative clitic and the preposition `a` as dative Case markers. Under this view, we further account for the realization of IO as a DP/weak pronoun, found in dialects of the central region of Brazil, which points to a similarity with the English Double Object Construction. Finally we show that the connection between the morphological expression of the dative Case and the expression of parameters supports a view of syntactic change according to which parametric variation is determined in the lexicon, in terms of the formal features of functional heads.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Beyond the first year after a heart transplant (HT) procedure, patients often develop dyslipidemias, which may be implicated in the genesis of transplant coronary heart disease. High-density lipoprotein (HDL) has a several anti-atherogenic properties, but the status of HDL in HT patients is still controversial. Nonetheless, determination of HDL cholesterol concentration is not sufficient for evaluation of the overall HDL protective role. In this study, a fundamental functional property of HDL, the ability to simultaneously receive the major lipid classes, was tested in HT patients. Methods: Twenty HT patients and 20 healthy normolipidemic subjects paired for gender, age and body mass index were studied. Blood samples were collected after 12-hour fasting for determination of plasma lipids, glucose, paraxonase I (PON 1) activity, HDL diameter and transfer of labeled lipids from an artificial nanoemulsion to HDL. Results: Plasma triglycerides (159 +/- 63 vs 94 +/- 35 mg/dl) and glucose (104 +/- 20 vs 86 +/- 10 mg/dl) were greater in HT patients than in control subjects. HDL cholesterol was lower and HDL diameter was smaller in the HT group (HDL cholesterol: 44 +/- 11 vs 55 +/- 15 mg/dl; HDL diameter: 8.8 +/- 0.6 vs 9.0 +/- 1.2 nm). PON 1 activity did not differ (87 +/- 47 vs 75 +/- 37 nmol/min/ml). The transfer rates of free cholesterol and cholesteryl esters were diminished in HT patients (HT: 8.4 +/- 1.2% and 3.8 +/- 0.6%; controls: 9.7 +/- 1.9% and 4.7 +/- 1.2%, respectively). Conclusions: The transfer of free cholesterol and cholesteryl esters to HDL is diminished in HT patients; disturbance in the ability of HDL to receive lipids may affect the anti-atherogenic properties of the lipoprotein. J Heart Lung Transplant 2009;28:1075-80. Copyright (C) 2009 by the International Society for Heart and Lung Transplantation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE- To determine whether obesity increases platelet reactivity and thrombin activity in patients with type 2 diabetes plus stable coronary artery disease. RESEARCH DESIGN AND METHODS- We assessed platelet reactivity and markers of thrombin generation and activity in 193 patients from nine clinical sites of the Bypass Angioplasty Revascularization Investigation 2 Diabetes (BARI 2D). Blood taken at the time of enrollment was used for assay of the concentration of prothrombin fragment 1.2 (PT1.2, released when prothrombin is activated) and fibrinopeptide A (FPA, released when fibrinogen is cleaved). Platelet activation was identified with the use of flow cytometry in response to 0, 0.2, and 1 mu mol/l adenosine diphosphate (ADP). RESULTS- Concentrations of FPA, PT1.2, and platelet activation in the absence of agonist were low. Greater BMI was associated with higher platelet reactivity in response to 1 mu m ADP as assessed by surface expression of P-selectin (r = 0.29, P < 0.0001) but not reflected by the binding of fibrinogen to activated glycoprotein IIb-IIIa. BMI was not associated with concentrations of FPA or PT1.2. Platelet reactivity correlated negatively with A1C (P < 0.04), was not related to the concentration Of triglycerides in blood, and did not correlate with the concentration of C-reactive peptide. CONCLUSIONS- Among patients enrolled in this substudy of BARI 2D, a greater BMI was associated with higher platelet reactivity at the time of enrollment. Our results suggest that obesity and insulin resistance that accompanies obesity may influence platelet reactivity in patients with type 2 diabetes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We theoretically study the Hilbert space structure of two neighboring P-donor electrons in silicon-based quantum computer architectures. To use electron spins as qubits, a crucial condition is the isolation of the electron spins from their environment, including the electronic orbital degrees of freedom. We provide detailed electronic structure calculations of both the single donor electron wave function and the two-electron pair wave function. We adopted a molecular orbital method for the two-electron problem, forming a basis with the calculated single donor electron orbitals. Our two-electron basis contains many singlet and triplet orbital excited states, in addition to the two simple ground state singlet and triplet orbitals usually used in the Heitler-London approximation to describe the two-electron donor pair wave function. We determined the excitation spectrum of the two-donor system, and study its dependence on strain, lattice position, and interdonor separation. This allows us to determine how isolated the ground state singlet and triplet orbitals are from the rest of the excited state Hilbert space. In addition to calculating the energy spectrum, we are also able to evaluate the exchange coupling between the two donor electrons, and the double occupancy probability that both electrons will reside on the same P donor. These two quantities are very important for logical operations in solid-state quantum computing devices, as a large exchange coupling achieves faster gating times, while the magnitude of the double occupancy probability can affect the error rate.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Non-syndromic cleft lip with or without cleft palate (NS CL/P) is a complex disease in which heritability estimates vary widely depending on the population studied. To evaluate the importance of genetic contribution to NS CL/P in the Brazilian population, we conducted a study with 1,042 families from five different locations (Santarem, Fortaleza, Barbalha, Maceio, and Rio de Janeiro). We also evaluated the role of consanguinity and ethnic background. The proportion of familial cases varied significantly across locations, with the highest values found in Santarem (44%) and the lowest in Maceio (23%). Heritability estimates showed a higher genetic contribution to NS CL/P in Barbalha (85%), followed by Santarem (71%), Rio de Janeiro (70%), Fortaleza (64%), and Maceio (45%). Ancestry was not correlated with the occurrence of NS CL/P or with the variability in heritability. Only in Rio de Janeiro was the coefficient of inbreeding significantly larger in NS CL/P families than in the local population. Recurrence risk for the total sample was approximately 1.5-1.6%, varying according to the location studied (0.6-0.7% in Maceio to 2.2-2.8% in Barbalha). Our findings show that the degree of genetic contribution to NS CL/P varies according to the geographic region studied, and this difference cannot be attributed to consanguinity or ancestry. These findings suggest that Barbalha is a promising region for genetic studies. The data presented here will be useful in interpreting results from molecular analyses and show that care must be taken when pooling samples from different populations for association studies. (C) 2011 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context: Thyroglobulin (TG) is a large glycoprotein and functions as a matrix for thyroid hormone synthesis. TG gene mutations give rise to goitrous congenital hypothyroidism (CH) with considerable phenotype variation. Objectives: The aim of the study was to report the genetic screening of 15 patients with CH due to TG gene mutations and to perform functional analysis of the p. A2215D mutation. Design: Clinical evaluation and DNA sequencing of the TG gene were performed in all patients. TG expression was analyzed in the goitrous tissue of one patient. Human cells were transfected with expression vectors containing mutated and wild-type human TG cDNA. Results: All patients had an absent rise of serum TG after stimulation with recombinant human TSH. Sequence analysis revealed three previously described mutations (p. A2215D, p. R277X, and g. IVS30 + 1G > T), and two novel mutations (p. Q2142X and g. IVS46-1G > A). Two known (g. IVS30 + 1G/p. A2215D and p. A2215D/p. R277X) and one novel (p. R277X/g. IVS46-1G > A) compound heterozygous constellations were also identified. Functional analysis indicated deficiency in TG synthesis, reduction of TG secretion, and retention of the mutant TG within the cell, leading to an endoplasmic reticulum storage disease, whereas small amounts of mutant TG were still secreted within the cell system. Conclusion: All studied patients were either homozygous or heterozygous for TG gene mutations. Two novel mutations have been detected, and we show that TG mutation p. A2215D promotes the retention of TG within the endoplasmic reticulum and reduces TG synthesis and secretion, causing mild hypothyroidism. In the presence of sufficient iodine supply, some patients with TG mutations are able to compensate the impaired hormonogenesis and generate thyroid hormone. (J Clin Endocrinol Metab 94: 2938-2944, 2009)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ninety-one consecutive systemic lupus erythematosus (SLE) patients (American College of Rheumatology criteria) with a history of cutaneous vasculitis were compared to 163 SLE controls without this clinical manifestation from July to December 2007 in order to determine the possible clinical and serological association of this manifestation. Data were obtained in an ongoing electronic database protocol and autoantibodies to anti-double-stranded DNA, anti-Sm, anti-RNP, anti-Ro/SS-A, anti-La/SS-B, and anticardiolipin and ribosomal P protein antibody (anti-P) were detected by standard techniques. Exclusion criteria were the presence of anti-phospholipid syndrome or antibodies, Sjogren syndrome, and a history of thrombosis. The mean age (38.5 +/- 11.5 vs. 37.8 +/- 11.6 years, p = 0.635), disease duration (12.5 +/- 7.8 vs. 11.8 +/- 7.9 years, p = 0.501), and frequency of white race (71.4% vs. 70.5%, p = 0.872) and female sex (96.8% vs. 93.7%, p = 0.272) were comparable in both groups. The vasculitis group had a higher frequency of malar rash (97.9% vs. 87.4%, p = 0.004), photosensitivity (91.4% vs. 81.6%, p = 0.030), and Raynaud phenomenon (RP; 27.7% vs. 7.5%, p < 0.001), whereas all other clinical manifestation including renal and central nervous system involvements were similar to the control group. Laboratorial data revealed that only anti-P (35.1% vs. 12.1%, p < 0.001) was more frequent in patients with vasculitis. In a multivariate logistic regression model, cutaneous vasculitis was associated to the presence of RP (OR = 3.70; 95% confidence interval [CI] = 1.73-8.00) and anti-P (OR = 3.42; 95% CI = 1.76-6.66). In summary, SLE cutaneous vasculitis characterizes a subgroup of patients with more RP and anti-P antibodies but not accompanied by a higher frequency of renal and central nervous system involvements.