Comparison of multitemporal MODIS-EVI smoothing algorithms and its contribution to crop monitoring.

Crop monitoring and more generally land use change detection are of primary importance in order to analyze spatio-temporal dynamics and its impacts on environment. This aspect is especially true in such a region as the State of Mato Grosso (south of the Brazilian Amazon Basin) which hosts an intensive pioneer front. Deforestation in this region as often been explained by soybean expansion in the last three decades. Remote sensing techniques may now represent an efficient and objective manner to quantify how crops expansion really represents a factor of deforestation through crop mapping studies. Due to the special characteristics of the soybean productions' farms in Mato Grosso (area varying between 1000 hectares and 40000 hectares and individual fields often bigger than 100 hectares), the Moderate Resolution Imaging Spectroradiometer (MODIS) data with a near daily temporal resolution and 250 m spatial resolution can be considered as adequate resources to crop mapping. Especially, multitemporal vegetation indices (VI) studies have been currently used to realize this task [1] [2]. In this study, 16-days compositions of EVI (MODQ13 product) data are used. However, although these data are already processed, multitemporal VI profiles still remain noisy due to cloudiness (which is extremely frequent in a tropical region such as south Amazon Basin), sensor problems, errors in atmospheric corrections or BRDF effect. Thus, many works tried to develop algorithms that could smooth the multitemporal VI profiles in order to improve further classification. The goal of this study is to compare and test different smoothing algorithms in order to select the one which satisfies better to the demand which is classifying crop classes. Those classes correspond to 6 different agricultural managements observed in Mato Grosso through an intensive field work which resulted in mapping more than 1000 individual fields. The agricultural managements above mentioned are based on combination of soy, cotton, corn, millet and sorghum crops sowed in single or double crop systems. Due to the difficulty in separating certain classes because of too similar agricultural calendars, the classification will be reduced to 3 classes : Cotton (single crop), Soy and cotton (double crop), soy (single or double crop with corn, millet or sorghum). The classification will use training data obtained in the 2005-2006 harvest and then be tested on the 2006-2007 harvest. In a first step, four smoothing techniques are presented and criticized. Those techniques are Best Index Slope Extraction (BISE) [3], Mean Value Iteration (MVI) [4], Weighted Least Squares (WLS) [5] and Savitzky-Golay Filter (SG) [6] [7]. These techniques are then implemented and visually compared on a few individual pixels so that it allows doing a first selection between the five studied techniques. The WLS and SG techniques are selected according to criteria proposed by [8]. Those criteria are: ability in eliminating frequent noises, conserving the upper values of the VI profiles and keeping the temporality of the profiles. Those selected algorithms are then programmed and applied to the MODIS/TERRA EVI data (16-days composition periods). Tests of separability are realized based on the Jeffries-Matusita distance in order to see if the algorithms managed in improving the potential of differentiation between the classes. Those tests are realized on the overall profile (comprising 23 MODIS images) as well as on each MODIS sub-period of the profile [1]. This last test is a double interest process because it allows comparing the smoothing techniques and also enables to select a set of images which carries more information on the separability between the classes. Those selected dates can then be used to realize a supervised classification. Here three different classifiers are tested to evaluate if the smoothing techniques as a particular effect on the classification depending on the classifiers used. Those classifiers are Maximum Likelihood classifier, Spectral Angle Mapper (SAM) classifier and CHAID Improved Decision tree. It appears through the separability tests on the overall process that the smoothed profiles don't improve efficiently the potential of discrimination between classes when compared with the original data. However, the same tests realized on the MODIS sub-periods show better results obtained with the smoothed algorithms. The results of the classification confirm this first analyze. The Kappa coefficients are always better with the smoothing techniques and the results obtained with the WLS and SG smoothed profiles are nearly equal. However, the results are different depending on the classifier used. The impact of the smoothing algorithms is much better while using the decision tree model. Indeed, it allows a gain of 0.1 in the Kappa coefficient. While using the Maximum Likelihood end SAM models, the gain remains positive but is much lower (Kappa improved of 0.02 only). Thus, this work's aim is to prove the utility in smoothing the VI profiles in order to improve the final results. However, the choice of the smoothing algorithm has to be made considering the original data used and the classifier models used. In that case the Savitzky-Golay filter gave the better results.

Intelligent Sensor Systems for Structural Health Monitoring Applications

The convergence between the recent developments in sensing technologies, data science, signal processing and advanced modelling has fostered a new paradigm to the Structural Health Monitoring (SHM) of engineered structures, which is the one based on intelligent sensors, i.e., embedded devices capable of stream processing data and/or performing structural inference in a self-contained and near-sensor manner. To efficiently exploit these intelligent sensor units for full-scale structural assessment, a joint effort is required to deal with instrumental aspects related to signal acquisition, conditioning and digitalization, and those pertaining to data management, data analytics and information sharing. In this framework, the main goal of this Thesis is to tackle the multi-faceted nature of the monitoring process, via a full-scale optimization of the hardware and software resources involved by the {SHM} system. The pursuit of this objective has required the investigation of both: i) transversal aspects common to multiple application domains at different abstraction levels (such as knowledge distillation, networking solutions, microsystem {HW} architectures), and ii) the specificities of the monitoring methodologies (vibrations, guided waves, acoustic emission monitoring). The key tools adopted in the proposed monitoring frameworks belong to the embedded signal processing field: namely, graph signal processing, compressed sensing, ARMA System Identification, digital data communication and TinyML.

Deep Learning Architectures for time of arrival detection in Acoustic Emissions Monitoring

Acoustic Emission (AE) monitoring can be used to detect the presence of damage as well as determine its location in Structural Health Monitoring (SHM) applications. Information on the time difference of the signal generated by the damage event arriving at different sensors is essential in performing localization. This makes the time of arrival (ToA) an important piece of information to retrieve from the AE signal. Generally, this is determined using statistical methods such as the Akaike Information Criterion (AIC) which is particularly prone to errors in the presence of noise. And given that the structures of interest are surrounded with harsh environments, a way to accurately estimate the arrival time in such noisy scenarios is of particular interest. In this work, two new methods are presented to estimate the arrival times of AE signals which are based on Machine Learning. Inspired by great results in the field, two models are presented which are Deep Learning models - a subset of machine learning. They are based on Convolutional Neural Network (CNN) and Capsule Neural Network (CapsNet). The primary advantage of such models is that they do not require the user to pre-define selected features but only require raw data to be given and the models establish non-linear relationships between the inputs and outputs. The performance of the models is evaluated using AE signals generated by a custom ray-tracing algorithm by propagating them on an aluminium plate and compared to AIC. It was found that the relative error in estimation on the test set was < 5% for the models compared to around 45% of AIC. The testing process was further continued by preparing an experimental setup and acquiring real AE signals to test on. Similar performances were observed where the two models not only outperform AIC by more than a magnitude in their average errors but also they were shown to be a lot more robust as compared to AIC which fails in the presence of noise.

Structural health monitoring of storage tanks

In this thesis, Ph.D candidate presents a compact sensor node (SN) designed for long-term and real-time acoustic emission (AE) monitoring of above ground storage tanks (ASTs). Each SN exploits up to three inexpensive low-frequency sensors based on piezoelectric diaphragms for effective leakage detection, and it is capable by means of built-in Digital Signal Processing functionalities to process the acquired time waveforms extracting the AE features usually required by testing protocols. Alternatively, capability to plug three high frequency AE sensors to a SN for corrosion simulated phenomena detection is envisaged and demonstrated. Another innovative aspect that the Ph.D candidate presents in this work is an alternative mathematical model of corrosion location on the bottom of the AST. This approach implies considering the three-dimensional localization model versus the two-dimensional commonly used according to the literature. This approach is aimed at significant optimization in the number of sensors in relation to the standard approach for solving localization problems as well as to allow filtering the false AE events related to the condensate droplets from AST ceiling. The technological implementation of this concept required the solution of a number of technical problems, such as the precise time of arrival (ToA) signal estimation, vertical localization of the AE source and multilaration solution that were discussed in detail in this work. To validate the developed prototype, several experimental campaigns were organized that included the simulation of target phenomena both in laboratory conditions and on a real water storage tank. The presented test results demonstrate the successful application of the developed AE system both for simulated leaks and for corrosion processes on the tank bottom. Mathematical and technological algorithms for localization and characterization of AE signals implemented during the development of the prototype are also confirmed by the test results.

Smart Textile Sensors for Healthcare Monitoring

Wearable electronic textiles are an emerging research field playing a pivotal role among several different technological areas such as sensing, communication, clothing, health monitoring, information technology, and microsystems. The possibility to realise a fully-textile platform, endowed with various sensors directly realised with textile fibres and fabric, represents a new challenge for the entire research community. Among several high-performing materials, the intrinsically conductive poly(3,4-ethylenedioxythiophene) (PEDOT), doped with poly(styrenesulfonic acid) (PSS), or PEDOT:PSS, is one of the most representative and utilised, having an excellent chemical and thermal stability, as well as reversible doping state and high conductivity. This work relies on PEDOT:PSS combined with sensible materials to design, realise, and develop textile chemical and physical sensors. In particular, chloride concentration and pH level sensors in human sweat for continuous monitoring of the wearer's hydration status and stress level are reported. Additionally, a prototype smart bandage detecting the moisture level and pH value of a bed wound to allow the remote monitoring of the healing process of severe and chronic wounds is described. Physical sensors used to monitor the pressure distribution for rehabilitation, workplace safety, or sport tracking are also presented together with a novel fully-textile device able to measure the incident X-ray dose for medical or security applications where thin, comfortable, and flexible features are essential. Finally, a proof-of-concept for an organic-inorganic textile thermoelectric generator that harvests energy directly from body heat has been proposed. Though further efforts must be dedicated to overcome issues such as durability, washability, power consumption, and large-scale production, the novel, versatile, and widely encompassing area of electronic textiles is a promising protagonist in the upcoming technological revolution.

Qualification of optical fiber sensors for the structural health monitoring of aerospace structures

In recent years, composite materials have revolutionized the design of many structures. Their superior mechanical properties and light weight make composites convenient over traditional metal structures for many applications. However, composite materials are susceptible to complex and challenging to predict damage behaviors due to their anisotropy nature. Therefore, structural Health Monitoring (SHM) can be a valuable tool to assess the damage and understand the physics underneath. Distributed Optical Fiber Sensors (DOFS) can be used to monitor several types of damage in composites. However, their implementation outside academia is still unsatisfactory. One of the hindrances is the lack of a rigorous methodology for uncertainty quantification, which is essential for the performance assessment of the monitoring system. The concept of Probability of Detection (POD) must function as the guiding light in this process. However, precautions must be taken since this tool was established for Non-Destructive Evaluation (NDE) rather than Structural Health Monitoring (SHM). In addition, although DOFS have been the object of numerous studies, a well-established POD methodology for their performance assessment is still missing. This thesis aims to develop a methodology to produce POD curves for DOFS in composite materials. The problem is analyzed considering several critical points, such as the strain transfer characterizing the DOFS and the development of an experimental and model-assisted methodology to understand the parameters that affect the DOFS performance.

[health Protection For Rural Workers: The Need To Standardize Techniques For Quantifying Dermal Exposure To Pesticides].

Quantification of dermal exposure to pesticides in rural workers, used in risk assessment, can be performed with different techniques such as patches or whole body evaluation. However, the wide variety of methods can jeopardize the process by producing disparate results, depending on the principles in sample collection. A critical review was thus performed on the main techniques for quantifying dermal exposure, calling attention to this issue and the need to establish a single methodology for quantification of dermal exposure in rural workers. Such harmonization of different techniques should help achieve safer and healthier working conditions. Techniques that can provide reliable exposure data are an essential first step towards avoiding harm to workers' health.

[meanings Of The Sickening Process For Patients With Systemic Lupus Erythematosus: A Review Of The Literature.]

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

[in Process Citation].

20

Química Analítica de Processos

Process Analytical Chemistry (PAC) is an important and growing area in analytical chemistry, that has received little attention in academic centers devoted to the gathering of knowledge and to optimization of chemical processes. PAC is an area devoted to optimization and knowledge acquisition of chemical processes, to reducing costs and wastes and to making an important contribution to sustainable development. The main aim of this review is to present to the Brazilian community the development and state of the art of PAC, discussing concepts, analytical techniques currently employed in the industry and some applications.

Efeitos da temperatura do ar, linhagem e período do dia nas freqüências de ocorrências e tempos de expressão comportamental de matrizes pesadas

Behavioral adjustments may occur fast and with less cost than the physiological adaptations. Considering the social behavior is suggestive that the frequency and the intensity of aggressive interactions, the total social cohesion and the extent of vicious attitudes may be used to evaluate welfare. This research presents an analysis of the interactions between the experimental factors such as temperature, genetic and time of the day in the behavior of female broiler breeders under controlled environment in a climatic chamber in order to enhance the different reaction of the birds facing distinct environmental conditions. The results showed significant differences between the behaviors expressed by the studied genetics presenting the need of monitoring them in real-time in order to predict their welfare in commercial housing, due to the complexity of the environmental variables that interfere in the well being process. The research also concluded that the welfare evaluation of female broiler breeders needs to consider the time of the day during the observation of the behaviors.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Praticas socioculturais, poder e diferenciação em Bico, Cuiamucu e Canela-Fina - comunidades amazonicas

Universidade Estadual de Campinas . Faculdade de Educação Física

O aluno com deficiência visual nas aulas de educação física : análise do processo inclusivo = The student with visual impairments : analysis of inclusive process

Universidade Estadual de Campinas . Faculdade de Educação Física

Hegemonia e contra-hegemonia na construção de políticas de esporte e lazer : a experiência do Consórcio Brasília = Hegemony and counter-hegemony in the process of sport and leisure policy-making : the experience of the Consortium Brasilia

Universidade Estadual de Campinas . Faculdade de Educação Física