Strand specificity in the transcriptional targeting of recombination at immunoglobulin switch sequences.

B-lymphocyte-specific class switch recombination is known to occur between pairs of 2- to 10-kb switch regions located immediately upstream of the immunoglobulin constant heavy-chain genes. Others have shown that the recombination is temporally correlated with the induction of transcription at the targeted switch regions. To determine whether this temporal correlation is due to a mechanistic linkage, we have developed an extrachromosomal recombination assay that closely recapitulates DNA deletional class switch recombination. In this assay, the rate of recombination is measured between 24 and 48 hr posttransfection. We find that recombinants are generated in a switch sequence-dependent manner. Recombination occurs with a predominance within B-cell lines representative of the mature B-cell stage and within a subset of pre-B-cell lines. Transcription stimulates the switch sequence-dependent recombination. Importantly, transcription activates recombination only when directed in the physiologic orientation but has no effect when directed in the nonphysiologic orientation.

Extraordinary divergence and positive Darwinian selection in a fusagenic protein coating the acrosomal process of abalone spermatozoa.

During fertilization in marine invertebrates, fusion between sperm and egg cell membranes occurs at the tip of the sperm acrosomal process. In abalone sperm the acrosomal process is coated with an 18-kDa protein. In situ, this protein has no effect on the egg vitelline envelope, but in vitro it is a potent fusagen of liposomes. Thus, the 18-kDa protein may mediate membrane fusion between the gametes, a step in gamete recognition known to restrict heterospecific fertilization in other species. The cDNA and deduced amino acid sequences of the 18-kDa protein were determined for five species of California abalone. The deduced amino acid sequences exhibit extraordinary divergence; the percent identity varies from 27% to 87%. Analysis of nucleotide substitution shows extremely high frequencies of amino acid-altering substitution compared to silent substitution, demonstrating that positive Darwinian selection promotes the divergence of this protein. However, amino acid replacement is conservative with respect to size and polarity of residue. The data support the developing idea that in free-spawning marine invertebrates, the proteins mediating fertilization may be subjected to intense, and as yet unknown, selective forces. The extraordinary divergence of fertilization proteins may be related to the establishment of barriers to heterospecific fertilization.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Stratigraphic and geochemical study of the organic-rich black shales in the Tarcău Nappe of the Moldavidian Domain (Carpathian Chain, Romania)

An integrated stratigraphic analysis has been made of the Tarcău Nappe (Moldavidian Domain, Eastern Romanian Carpathians), coupled with a geochemical study of organic-rich beds. Two Main Sequence Boundaries (Early Oligocene and near to the Oligocene–Aquitanian boundary, respectively) divide the sedimentary record into three depositional sequences. The sedimentation occurred in the central area of a basin supplied by different and opposite sources. The high amount of siliciclastics at the beginning of the Miocene marks the activation of the “foredeep stage”. The successions studied are younger than previously thought and they more accurately date the deformation of the different Miocene phases affecting the Moldavidian Basin. The intervals with black shales identified are related to two main separate anoxic episodes with an age not older than Late Rupelian and not before Late Chattian. The most important organic-rich beds correspond to the Lower Menilites, Bituminous Marls and Lower Dysodilic Shales Members (Interval 2). These constitute a good potential source rock for petroleum, with homogeneous Type II oil-prone organic matter, highly lipidic and thermally immature. The deposition of black shales has been interpreted as occurring within a deep, periodically isolated and tectonically controlled basin.

A sensitive, specific, and cost-effective multiplex reverse transcriptase-PCR assay for the detection of seven common respiratory viruses in respiratory samples

Cell culture and direct fluorescent antibody (DFA) assays have been traditionally used for the laboratory diagnosis of respiratory viral infections. Multiplex reverse transcriptase polymerase chain reaction (m-RT-PCR) is a sensitive, specific, and rapid method for detecting several DNIA and RNA viruses in a single specimen. We developed a m-RT-PCR assay that utilizes multiple virus-specific primer pairs in a single reaction mix combined with an enzyme-linked amplicon hybridization assay (ELAHA) using virus-specific probes targeting unique gene sequences for each virus. Using this m-RT-PCR-ELAHA, we examined the presence of seven respiratory viruses in 598 nasopharyngeal aspirate (NPA) samples from patients with suspected respiratory infection. The specificity of each assay was 100%. The sensitivity of the DFA was 79.7% and the combined DFA/culture amplified-DFA (CA-DFA) was 88.6% when compared to the m-RT-PCR-ELAHA. Of the 598 NPA specimens screened by m-RT-PCR-ELAHA, 3% were positive for adenovirus (ADM), 2% for influenza A (Flu A) virus, 0.3% for influenza B (Flu B) virus, 1% for parainfluenza type I virus (PIV1), 1% for parainfluenza type 2 virus (PIV2), 5.5% for parainfluenza type 3 virus (PIV3), and 21% for respiratory syncytial virus (RSV). The enhanced sensitivity, specificity, rapid result turnaround time and reduced expense of the m-RT-PCR-ELAHA compared to DFA and CA-DFA, suggests that this assay would be a significant improvement over traditional assays for the detection of respiratory viruses in a clinical laboratory.

Adenosine triphosphate acts as both a competitive antagonist and a positive allosteric modulator at recombinant N-methyl-D-aspartate receptors

ATP and glutamate are fast excitatory neurotransmitters in the central nervous system acting primarily on ionotropic P2X and glutamate [N-methyl-D-aspartate (NMDA) and non-NMDA] receptors, respectively. Both neurotransmitters regulate synaptic plasticity and long-term potentiation in hippocampal neurons. NMDA receptors are responsible primarily for the modulatory action of glutamate, but the mechanism underlying the modulatory effect of ATP remains uncertain. In the present study, the effect of ATP on recombinant NR1a + 2A, NR1a + 2B, and NR1a + 2C NMDA receptors expressed in Xenopus laevis oocytes was investigated. ATP inhibited NR1a + 2A and NR1a + 2B receptor currents evoked by low concentrations of glutamate but potentiated currents evoked by saturating glutamate concentrations. In contrast, ATP potentiated NR1a + 2C receptor currents evoked by nonsaturating glutamate concentrations. ATP shifted the glutamate concentration-response curve to the right, indicating a competitive interaction at the agonist binding site. ATP inhibition and potentiation of glutamate-evoked currents was voltage-independent, indicating that ATP acts outside the membrane electric field. Other nucleotides, including ADP, GTP, CTP, and UTP, inhibited glutamate-evoked currents with different potencies, revealing that the inhibition is dependent on both the phosphate chain and nucleotide ring structure. At high concentrations, glutamate outcompetes ATP at the agonist binding site, revealing a potentiation of the current. This effect must be caused by ATP binding at a separate site, where it acts as a positive allosteric modulator of channel gating. A simple model of the NMDA receptor, with ATP acting both as a competitive antagonist at the glutamate binding site and as a positive allosteric modulator at a separate site, reproduced the main features of the data.

Marine actinomycetes related to the 'Salinospora' group from the Great Barrier Reef sponge Pseudoceratina clavata

Ten strains identified as marine actinomycetes related to the 'Salinospora ' group previously reported only from marine sediments were isolated from the Great Barrier Reef marine sponge Pseudoceratina clavata. The relationship of the isolates to 'Salinospora' was confirmed by phylogenetic analysis of 16S rRNA gene sequences. Colony morphology and pigmentation, occurrence and position of spores, and salinity requirements for growth were all consistent with this relationship. Genes homologous to beta-ketosynthase, an enzyme forming part of a polyketide synthesis complex, were retrieved from these isolates; these genes shared homology with other Type I ketosynthase genes, and phylogenetic comparison with amino acid sequences derived from database beta-ketosynthase genes was consistent with the close relationship of these isolates to the actinomycetes. Primers based on 16S rRNA gene sequences and designed for targeting amplification of members of the 'Salinospora' group via polymerase chain reaction have been used to demonstrate occurrence of these actinomycetes within the sponge tissue. In vitro bioassays of extracts from the isolates for antibiotic activity demonstrated that these actinomycetes have the potential to inhibit other sponge symbionts in vivo, including both Gram-negative and Gram-positive bacteria.

Intramolecular disulphide bond arrangements in nonhomologous proteins

The presence and location of intramolecular disulphide bonds are a key determinant of the structure and function of proteins. Intramolecular disulphide bonds in proteins have previously been analyzed under the assumption that there is no clear relationship between disulphide arrangement and disulphide concentration. To investigate this, a set of sequence nonhomologous protein chains containing one or more intramolecular disulphide bonds was extracted from the Protein Data Bank, and the arrangements of the bonds, Protein Data Bank header, and Structural Characterization of Proteins fold were analyzed as a function of intramolecular, containing proteins were disulphide bond concentration. Two populations of intramolecular disulphide bond-containing identified, with a naturally occurring partition at 25 residues per bond. These populations were named intramolecular disulphide bond-rich and -poor. Benefits of partitioning were illustrated by three results: (1) rich chains most frequently contained three disulphides, explaining the plateaux in extant disulphide frequency distributions; (2) a positive relationship between median chain length and the number of disulphides, only seen when the data were partitioned-, and (3) the most common bonding pattern for chains with three disulphide bonds was based on the most common for two, only when the data were partitioned. The two populations had different headers, folds, bond arrangements, and chain lengths. Associations between IDSB concentration, IDSB bonding pattern, loop sizes, SCOP fold, and PDB header were also found. From this, we found that intramolecular disulphide bond-rich and -poor proteins follow different bonding rules, and must be considered separately to generate meaningful models of bond formation.

Development of an oligonucleotide-based SNP detection method on lateral flow strips using hexapet tages

Detection of point mutations or single nucleotide polymorphisms (SNPs) is important in relation to disease susceptibility or detection in pathogens of mutations determining drug resistance or host range. There is an emergent need for rapid detection methods amenable to point-of-care applications. The purpose of this study was to reduce to practice a novel method for SNP detection and to demonstrate that this technology can be used downstream of nucleic acid amplification. The authors used a model system to develop an oligonucleotide-based SNP detection system on nitrocellulose lateral flow strips. To optimize the assay they used cloned sequences of the herpes simplex virus-1 (HSV-1) DNA polymerase gene into which they introduced a point mutation. The assay system uses chimeric polymerase chain reaction (PCR) primers that incorporate hexameric repeat tags ("hexapet tags"). The chimeric sequences allow capture of amplified products to predefined positions on a lateral flow strip. These "hexapet" sequences have minimal cross-reactivity and allow specific hybridization-based capture of the PCR products at room temperature onto lateral flow strips that have been striped with complementary hexapet tags. The allele-specific amplification was carried out with both mutant and wild-type primer sets present in the PCR mix ("competitive" format). The resulting PCR products carried a hexapet tag that corresponded with either a wild-type or mutant sequence. The lateral flow strips are dropped into the PCR reaction tube, and mutant sequence and wild-type sequences diffuse along the strip and are captured at the corresponding position on the strip. A red line indicative of a positive reaction is visible after 1 minute. Unlike other systems that require separate reactions and strips for each target sequence, this system allows multiplex PCR reactions and multiplex detection on a single strip or other suitable substrates. Unambiguous visual discrimination of a point mutation under room temperature hybridization conditions was achieved with this model system in 10 minutes after PCR. The authors have developed a capture-based hybridization method for the detection and discrimination of HSV-1 DNA polymerase genes that contain a single nucleotide change. It has been demonstrated that the hexapet oligonucleotides can be adapted for hybridization on the lateral flow strip platform for discrimination of SNPs. This is the first step in demonstrating SNP detection on lateral flow using the hexapet oligonucleotide capture system. It is anticipated that this novel system can be widely used in point-of-care settings.

Meganema perideroedes gen. nov., sp nov., a filamentous alphaproteobacterium from activated sludge

An industrial wastewater treatment plant at Grindsted, Denmark, has suffered from bulking problems for several years caused by filamentous bacteria. Five strains were isolated from the sludge by micromanipulation, Phylogenetic analysis of the 16S rRNA gene sequences showed that the strains formed a monophyletic cluster in the Alphaproteobacteria, and they were phenotypically different from their closest relatives and from all hitherto known filamentous bacteria described (closest relative Brevundimonas vesicularis ATCC 11426(T), 89(.)8% sequence similarity). In pure culture, the cells (1(.)5-2(.)0 mu m) in filaments are Gram-negative and contain polyphosphate and polyhydroxyalkanoates. The optimum temperature for growth is 30 degrees C and the strains grow in 2 % NaCl and are oxidase- and catalase-positive. Ubiquinone 10 is the major quinone. The major fatty acid (C-18: 1 omega 7c) and smaller amounts of unsaturated fatty acids, 3-hydroxy fatty acids with a chain length of 16 and 18 carbon atoms and small amounts of 10-methyl-branched fatty acids with 18 carbon atoms (C-19: 0 10-methyl) affiliated the strains with the Methylobacterium/Xanthobacter group in the Alphaproteobacteria. The G + C content of the DNA is 42(.)9 mol% (for strain Gr1(T)). The two most dissimilar isolates by 16S rRNA gene comparison (Gr1(T) and Gr10; 97(.)7 % identical) showed 71(.)5 % DNA-DNA relatedness. Oligonucleotide probes specific for the pure cultures were designed for fluorescence in situ hybridization and demonstrated that two filamentous morphotypes were present in the Grindsted wastewater treatment plant. It is proposed that the isolates represent a new genus and species, Meganema perideroedes gen. nov., sp. nov. The type strain of Meganema perideroedes is strain Gr1(T) (=DSM 15528(T) =ATCC BAA-740(T)).

Nucleic acid amplification testing for Neisseria gonorrhoeae: An ongoing challenge

Nucleic acid amplification tests (NAATs) for the detection of Neisseria gonorrhoeae became available in the early 1990s. Although offering several advantages over traditional detection methods, N. gonorrhoeae NAATs do have some limitations. These include cost, risk of carryover contamination, inhibition, and inability to provide antibiotic resistance data. In addition, there are sequence-related limitations that are unique to N. gonorrhoeae NAATs. In particular, false-positive results are a major consideration. These primarily stem from the frequent horizontal genetic exchange occurring within the Neisseria genus, leading to commensal Neisseria species acquiring N. gonorrhoeae genes. Furthermore, some N. gonorrhoeae subtypes may lack specific sequences targeted by a particular NAAT. Therefore, NAAT false-negative results because of sequence variation may occur in some gonococcal populations. Overall, the N. gonorrhoeae species continues to present a considerable challenge for molecular diagnostics. The need to evaluate N. gonorrhoeae NAATs before their use in any new patient population and to educate physicians on the limitations of these tests is emphasized in this review.

Searching for convergence in phylogenetic Markov chain Monte Carlo

Markov chain Monte Carlo (MCMC) is a methodology that is gaining widespread use in the phylogenetics community and is central to phylogenetic software packages such as MrBayes. An important issue for users of MCMC methods is how to select appropriate values for adjustable parameters such as the length of the Markov chain or chains, the sampling density, the proposal mechanism, and, if Metropolis-coupled MCMC is being used, the number of heated chains and their temperatures. Although some parameter settings have been examined in detail in the literature, others are frequently chosen with more regard to computational time or personal experience with other data sets. Such choices may lead to inadequate sampling of tree space or an inefficient use of computational resources. We performed a detailed study of convergence and mixing for 70 randomly selected, putatively orthologous protein sets with different sizes and taxonomic compositions. Replicated runs from multiple random starting points permit a more rigorous assessment of convergence, and we developed two novel statistics, delta and epsilon, for this purpose. Although likelihood values invariably stabilized quickly, adequate sampling of the posterior distribution of tree topologies took considerably longer. Our results suggest that multimodality is common for data sets with 30 or more taxa and that this results in slow convergence and mixing. However, we also found that the pragmatic approach of combining data from several short, replicated runs into a metachain to estimate bipartition posterior probabilities provided good approximations, and that such estimates were no worse in approximating a reference posterior distribution than those obtained using a single long run of the same length as the metachain. Precision appears to be best when heated Markov chains have low temperatures, whereas chains with high temperatures appear to sample trees with high posterior probabilities only rarely. [Bayesian phylogenetic inference; heating parameter; Markov chain Monte Carlo; replicated chains.]

Molecular subtyping of feline immunodeficiency virus from domestic cats in Australia

Objective To determine the prevalent subtypes of feline immunodeficiency virus (FIV) present in the domestic cat population of Australia. Method Blood samples were collected from 41 FIV antibody positive cats from four cities across Australia. Following DNA extraction, polymerase chain reaction (PCR) was performed to amplify the variable V3-V5 region of the envelope (env) gene. Genotypes were assessed by direct sequencing of PCR products and comparison with previously reported FIV sequences. Phylogenetic analysis allowed classification of the Australian sequences into the appropriate subtype. Results Of the 41 FIV samples, 40 were found to cluster with previously reported subtype A isolates, whilst the remaining sample grouped within subtype B. Conclusions Subtype A was found to be the predominant FIV subtype present in Australia, although subtype B was also found. These results broaden our knowledge of the genetic diversity of FIV and the associated implications for preventative, diagnostic and therapeutic approaches.

Determination of organ tropism of Newcastle disease virus (strain I-2) by virus isolation and reverse transcription-polymerase chain reaction

The vaccines 1-2 and V4 are avirulent strains of Newcastle disease virus. Organ tropism of strain V4 has been determined and the virus has a predilection for the digestive tract. Tropism of strain 1-2 has not yet been determined. The objective of this study was to determine the distribution of strain 1-2 in various body organs and fluids following vaccination in comparison with V4. Four-week-old chickens were vaccinated by eye drop separately with these two avirulent strains. Virus isolation and the reverse transcription-polymerase chain reaction technique were employed to detect 1-2 and V4 viruses in various tissues and body fluids for 7 days following vaccination. Tissues from the respiratory tract showed earlier positive signals than tissues from other organs for chickens vaccinated with strain 1-2. Conversely, tissues from mainly digestive tract produced earlier positive signals than from respiratory tract and other organs from chickens vaccinated with strain V4. In early infection, strain 1-2 had preferential predilection for the respiratory tract and strain V4 for the digestive tract. Later after vaccination, other organs showed positive results from chickens vaccinated with both 1-2 and V4 strains. The differences in organ tropism observed in this study suggest that 1-2 may perform better than V4 as a live vaccine strain.

Finding negative event oriented patterns in long temporal sequences

Pattern discovery in a long temporal event sequence is of great importance in many application domains. Most of the previous work focuses on identifying positive associations among time stamped event types. In this paper, we introduce the problem of defining and discovering negative associations that, as positive rules, may also serve as a source of knowledge discovery. In general, an event-oriented pattern is a pattern that associates with a selected type of event, called a target event. As a counter-part of previous research, we identify patterns that have a negative relationship with the target events. A set of criteria is defined to evaluate the interestingness of patterns associated with such negative relationships. In the process of counting the frequency of a pattern, we propose a new approach, called unique minimal occurrence, which guarantees that the Apriori property holds for all patterns in a long sequence. Based on the interestingness measures, algorithms are proposed to discover potentially interesting patterns for this negative rule problem. Finally, the experiment is made for a real application.