972 resultados para Modified reflected normal loss function


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Reggies/flotillins are implicated in trafficking of membrane proteins to their target sites and in the regulation of the Rab11a-dependent targeted recycling of E-cadherin to adherens junctions (AJs). Here we demonstrate a function of reggies in focal adhesion (FA) formation and α5- and β1-integrin recycling to FAs. Downregulation of reggie-1 in HeLa and A431 cells by siRNA and shRNA increased the number of FAs, impaired their distribution and modified FA turnover. This was coupled to enhanced focal adhesion kinase (FAK) and Rac1 signaling and gain in plasma membrane motility. Wild type and constitutively-active (CA) Rab11a rescued the phenotype (normal number of FAs) whereas dominant-negative (DN) Rab11a mimicked the loss-of-reggie phenotype in control cells. That reggie-1 affects integrin trafficking emerged from the faster loss of internalized antibody-labeled β1-integrin in reggie-deficient cells. Moreover, live imaging using TIRF microscopy revealed vesicles containing reggie-1 and α5- or β1-integrin, trafficking close to the substrate-near membrane and making kiss-and-run contacts with FAs. Thus, reggie-1 in interaction with Rab11a controls Rac1 and FAK activation and coordinates the targeted recycling of α5- and β1-integrins to FAs to regulate FA formation and membrane dynamics.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The POU4F2/Brn-3b transcription factor has been identified as a potentially novel regulator of key metabolic processes. Loss of this protein in Brn-3b knockout (KO) mice causes profound hyperglycemia and insulin resistance (IR), normally associated with type 2 diabetes (T2D), whereas Brn-3b is reduced in tissues taken from obese mice fed on high-fat diets (HFD), which also develop hyperglycemia and IR. Furthermore, studies in C2C12 myocytes show that Brn-3b mRNA and proteins are induced by glucose but inhibited by insulin, suggesting that this protein is itself highly regulated in responsive cells. Analysis of differential gene expression in skeletal muscle from Brn-3b KO mice showed changes in genes that are implicated in T2D such as increased glycogen synthase kinase-3β and reduced GLUT4 glucose transporter. The GLUT4 gene promoter contains multiple Brn-3b binding sites and is directly transactivated by this transcription factor in cotransfection assays, whereas chromatin immunoprecipitation assays confirm that Brn-3b binds to this promoter in vivo. In addition, correlation between GLUT4 and Brn-3b in KO tissues or in C2C12 cells strongly supports a close association between Brn-3b levels and GLUT4 expression. Since Brn-3b is regulated by metabolites and insulin, this may provide a mechanism for controlling key genes that are required for normal metabolic processes in insulin-responsive tissues and its loss may contribute to abnormal glucose uptake.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Intestinal infection with Salmonella enterica serotype Enteritidis, a food-borne infection spread to humans especially through contaminated eggs and egg-products as well as undercooked contaminated fresh meat, is the most common cause of intestinal inflammation in the European Union. Enteritis caused by Salmonella Enteritidis is characterized by fever, diarrhoea and abdominal pain. The disruption of the intestinal epithelial barrier function contributes to diarrhoea and is responsible for the perpetuation of the inflammatory process. In this sense, oxidative stress and the proinflammatory cytokines TNF-α, IFN-γ and IL-1β are described to induce the disorganization of the tight junctions (TJ), the most apical epithelial intercellular junctions and responsible for the paracellular permeability. The interest of this chapter relies not only in the investigation dealing with the mechanisms of TJ regulation but also in the contribution to the development of new tools for the prevention of epithelial barrier disruption in enteritis caused by Salmonella Enteritidis.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

ABSTRACTPeanut crop (Arachis hypogaeaL.) mechanization has been improved over the years; however there are drawbacks that affect the quality of operations. Thus, this article’s objectives were to evaluate the operational performance of the mechanized sowing of peanut crop according to seeding densities (10, 14, and 18 seeds m-1) and seed sizes (21 and 23 mm). It was observed that the seeds of 23 mm had shorter average number of days to emergence and a higher percentage of emergences, occurring the opposite to the seeding density of 18 seeds m-1. The higher the seeding density, the largest was the plant stand, whereas the 23 mm seed obtained the best results and the same with the seeding density of 14 seeds m-1 that had a higher percentage of normal spacing. The densities of 14 and 18 seeds m-1 reflected in higher yields, being always superior to the 23 mm seeds.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Objective We studied the effects of loss of ovarian function (ovariectomy) onmuscle mass of gastrocnemius and themRNA levels of IGF-1, atrogin-1, MuRF-1, andmyostatin in an experimental model of rheumatoid arthritis in rats. Methods We randomly allocated 24 female Wistar rats (9 weeks, 195.3±17.4 grams) into four groups: control (CT-Sham; n = 6); rheumatoid arthritis (RA; n = 6); ovariectomy without rheumatoid arthritis (OV; n = 6); ovariectomy with rheumatoid arthritis (RAOV; n = 6). We performed the ovariectomy (OV and RAOV) or Sham (CTSham or RA) procedures at the same time, fifteen days before the rheumatoid arthritis induction. The RA and RAOV groups were immunized and then were injected with Met- BSA in the tibiotarsal joint. After 15 days of intra-articular injections the animals were euthanized. We evaluated the external manifestations of rheumatoid arthritis (perimeter joint) as well as animal weight, and food intake throughout the study. We also analyzed the cross-sectional areas (CSA) of gastrocnemius muscle fibers in 200 fibers (H&E method). In the gastrocnemius muscle, we analyzed mRNA expression by quantitative real time PCR followed by the Livak method (ΔΔCT). Results The rheumatoid arthritis induced reduction in CSA of gastrocnemius muscle fibers. The RAOV group showed a lower CSA of gastrocnemius muscle fibers compared to RA and CT-Sham groups. Skeletal muscle IGF-1 mRNA increased in arthritics and ovariectomized rats. The increased IGF-1 mRNA was higher in OV groups than in the RA and RAOV groups. Antrogin-1 mRNA also increased in the gastrocnemius muscle of arthritic and ovariectomized rats. However, the increased atrogin-1 mRNA was higher in RAOV groups than in the RA and OV groups. Gastrocnemius muscle MuRF-1 mRNA increased in the OVand RAOVgroups, but not in the RA and Shamgroups. However, the RAOV group showed higher MuRF-1 mRNA than the OV group. The myostatin gene expression was similar in all groups. Conclusion Loss of ovarian function results in increased loss of skeletal musclerelated ubiquitin ligases atrogin-1 and MuRF-1 in arthritic rats.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The cell is continuously subjected to various forms of external and intrinsic proteindamaging stresses, including hyperthermia, pathophysiological states, as well as cell differentiation and proliferation. Proteindamaging stresses result in denaturation and improper folding of proteins, leading to the formation of toxic aggregates that are detrimental for various pathological conditions, including Alzheimer’s and Huntington’s diseases. In order to maintain protein homeostasis, cells have developed different cytoprotective mechanisms, one of which is the evolutionary well-conserved heat shock response. The heat shock response results in the expression of heat shock proteins (Hsps), which act as molecular chaperones that bind to misfolded proteins, facilitate their refolding and prevent the formation of protein aggregates. Stress-induced expression of Hsps is mediated by a family of transcription factors, the heat shock factors, HSFs. Of the four HSFs found in vertebrates, HSF1-4, HSF1 is the major stress-responsive factor that is required for the induction of the heat shock response. HSF2 cannot alone induce Hsps, but modulates the heat shock response by forming heterotrimers with HSF1. HSFs are not only involved in the heat shock response, but they have also been found to have a function in development, neurodegenerative disorders, cancer, and longevity. Therefore, insight into how HSFs are regulated is important for the understanding of both normal physiological and disease processes. The activity of HSF1 is mainly regulated by intricate post-translational modifications, whereas the activity of HSF2 is concentrationdependent. However, there is only limited understanding of how the abundance of HSF2 is regulated. This study describes two different means of how HSF2 levels are regulated. In the first study it was shown that microRNA miR-18, a member of the miR-17~92 cluster, directly regulates Hsf2 mRNA stability and thus protein levels. HSF2 has earlier been shown to play a profound role in the regulation of male germ cell maturation during the spermatogenesis. The effect on miR-18 on HSF2 was examined in vivo by transfecting intact seminiferous tubules, and it was found that inhibition of miR-18 resulted in increased HSF2 levels and modified expression of the HSF2 targets Ssty2 and Speer4a. HSF2 has earlier been reported to modulate the heat shock response by forming heterotrimers with HSF1. In the second study, it was shown that HSF2 is cleared off the Hsp70 promoter and degraded by the ubiquitinproteasome pathway upon acute stress. By silencing components of the anaphase promoting complex/cyclosome (APC/C), including the co-activators Cdc20 and Cdh1, it was shown that APC/C mediates the heatinduced ubiquitylation of HSF2. Furthermore, down-regulation of Cdc20 was shown to alter the expression of heat shock-responsive genes. Next, we studied if APC/C-Cdc20, which controls cell cycle progression, also regulates HSF2 during the cell cycle. We found that both HSF2 mRNA and protein levels decreased during mitosis in several but not all human cell lines, indicating that HSF2 has a function in mitotic cells. Interestingly, although transcription is globally repressed during mitosis, mainly due to the displacement of RNA polymerase II and transcription factors, including HSF1, from the mitotic chromatin, HSF2 is capable of binding DNA during mitosis. Thus, during mitosis the heat shock response is impaired, leaving mitotic cells vulnerable to proteotoxic stress. However, in HSF2-deficient mitotic cells the Hsp70 promoter is accessible to both HSF1 and RNA polymerase II, allowing for stress-inducible Hsp expression to occur. As a consequence HSF2-deficient mitotic cells have a survival advantage upon acute heat stress. The results, presented in this thesis contribute to the understanding of the regulatory mechanisms of HSF2 and its function in the heat shock response in both interphase and mitotic cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

This thesis presents point-contact measurements between superconductors (Nb, Ta, Sn,Al, Zn) and ferromagnets (Co, Fe, Ni) as well as non-magnetic metals (Ag, Au, Cu, Pt).The point contacts were fabricated using the shear method. The differential resistanceof the contacts was measured either in liquid He at 4.2 K or in vacuum in a dilutionrefrigerator at varying temperature down to 0.1 K. The contact properties were investigatedas function of size and temperature. The measured Andreev-reflection spectrawere analysed in the framework of the BTK model – a three parameter model that describescurrent transport across a superconductor - normal conductor interface. Theoriginal BTK model was modified to include the effects of spin polarization or finitelifetime of the Cooper pairs. Our polarization values for the ferromagnets at 4.2 K agree with the literature data, but the analysis was ambiguous because the experimental spectra both with ferromagnets and non-magnets could be described equally well either with spin polarization or finite lifetime effects in the BTK model. With the polarization model the Z parametervaries from almost 0 to 0.8 while the lifetime model produces Z values close to 0.5. Measurements at lower temperatures partly lift this ambiguity because the magnitude of thermal broadening is small enough to separate lifetime broadening from the polarization. The reduced magnitude of the superconducting anomalies for Zn-Fe contacts required an additional modification of the BTK model which was implemented as a scaling factor. Adding this parameter led to reduced polarization values. However, reliable data is difficult to obtain because different parameter sets produce almost identical spectra.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The multidrug resistance P-glycoprotein is a transmembrane efflux pump expressed by lymphocytes and is involved in their cytolytic activity. In the present study, we investigated the age-related changes of P-glycoprotein function in normal peripheral blood lymphocytes. Blood samples from 90 normal volunteers (age range, 0 to 86 years) were analyzed. P-glycoprotein function was assessed by the flow cytometric rhodamine 123 assay. P-glycoprotein function was highest in cord blood and progressively declined with age in peripheral blood T CD4+ and CD8+ cells. In contrast, P-glycoprotein function did not vary with age in CD19+ B or CD16+CD56+ natural killer cells. These data suggest that the decline in P-glycoprotein function in T CD4+ and CD8+ lymphocytes as a function of age may contribute to the decrease in T cell cytolytic activity with aging.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

In the present study we determined the effect of chronic diet supplementation with n-3 PUFA on renal function of healthy and cachectic subjects by providing fish oil (1 g/kg body weight) to female rats throughout pregnancy and lactation and then to their offspring post-weaning and examined its effect on renal function parameters during their adulthood. The animals were divided into four groups of 5-10 rats in each group: control, control supplemented with fish oil (P), cachectic Walker 256 tumor-bearing (W), and W supplemented with fish oil (WP). Food intake was significantly lower in the W group compared to control (12.66 ± 4.24 vs 25.30 ± 1.07 g/day). Treatment with fish oil significantly reversed this reduction (22.70 ± 2.94 g/day). Tumor growth rate was markedly reduced in the P group (16.41 ± 2.09 for WP vs 24.06 ± 2.64 g for W). WP group showed a significant increase in mean glomerular filtration rate compared to P and control (1.520 ± 0.214 ml min-1 kg body weight-1; P < 0.05). Tumor-bearing groups had low urine osmolality compared to control rats. The fractional sodium excretion decreased in the W group compared to control (0.43 ± 0.16 vs 2.99 ± 0.87%; P < 0.05), and partially recovered in the WP group (0.90 ± 0.20%). In summary, the chronic supplementation with fish oil used in this study increased the amount of fat in the diet by only 0.1%, but caused remarkable changes in tumor growth rate and cachexia, also showing a renoprotective function.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Obesity is one of the key challenges to health care system worldwide and its prevalence is estimated to rise to pandemic proportions. Numerous adverse health effects follow with increasing body weight, including increased risk of hypertension, diabetes, hypercholesterolemia, musculoskeletal pain and cancer. Current evidence suggests that obesity is associated with altered cerebral reward circuit functioning and decreased inhibitory control over appetitive food cues. Furthermore, obesity causes adverse shifts in metabolism and loss of structural integrity within the brain. Prior cross-sectional studies do not allow delineating which of these cerebral changes are recoverable after weight loss. We compared morbidly obese subjects with healthy controls to unravel brain changes associated with obesity. Bariatric surgery was used as an intervention to study which cerebral changes are recoverable after weight loss. In Study I we employed functional magnetic resonance imaging (fMRI) to detect the brain basis of volitional appetite control and its alterations in obesity. In Studies II-III we used diffusion tensor imaging (DTI) and voxel-based morphometry (VBM) to quantify the effects of obesity and the effects of weight loss on structural integrity of the brain. In study IV we used positron emission tomography (PET) with [18F]-FDG in fasting state and during euglycemic hyperinsulinemia to quantify effects of obesity and weight loss on brain glucose uptake. The fMRI experiment revealed that a fronto-parietal network is involved in volitional appetite control. Obese subjects had lower medial frontal and dorsal striatal brain activity during cognitive appetite control and increased functional connectivity within the appetite control circuit. Obese subjects had initially lower grey matter and white matter densities than healthy controls in VBM analysis and loss of integrity in white matter tracts as measured by DTI. They also had initially elevated glucose metabolism under insulin stimulation but not in fasting state. After the weight loss following bariatric surgery, obese individuals’ brain volumes recovered and the insulin-induced increase in glucose metabolism was attenuated. In conclusion, obesity is associated with altered brain function, coupled with loss of structural integrity and elevated glucose metabolism, which are likely signs of adverse health effects to the brain. These changes are reversed by weight loss after bariatric surgery, implicating that weight loss has a causal role on these adverse cerebral changes. Altogether these findings suggest that weight loss also promotes brain health.Key words: brain, obesity, bariatric surgery, appetite control, structural magnetic resonance

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Phycobilisomes are the major light harvesting complexes for cyanobacteria and phycocyanin is the primary phycobiliprotein of the phycobilisome rod. The phycocyanobilin lyases responsible for chromophorylating the phycocyanin p subunit (CpcB) have been recently identified in the cyanobacterium Synechococcus sp. PCC 7002. Surprisingly, mutants missing the CpcB lyases were nevertheless capable of producing pigmented phycocyanin. 10K absorbance measurements revealed that the energy states of the p phycocyanin chromophores were only subtly shifted; however, 77K steady state fluorescence emission spectroscopy showed excitation energy transfer involving the targeted chromophores to be highly disrupted. Such evidence suggests that phycobilin orientation within the binding domain is specifically modified. We hypothesized that alternate, less specific lyases are able to act on the p binding sites. A phycocyanin linker-polypeptide deficient mutant was similarly characterized. The light state transition, a short term adaptation of the photosynthetic light harvesting apparatus resulting in the redistribution of excitation energy among the photo systems, was shown to be dominated by the reallocation of phycocyanin-absorbed excitation energy. Treatment with a high M phosphate buffer effectively prevented the redistribution of both chlorophyll a- and phycobilisome- absorbed excitation energy, suggesting that the two effects are not strictly independent. The mutant strains required a larger redistribution of excitation energy between light states, perhaps to compensate for their loss in phycobilisome antenna function.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Daytime napping improves well-being and performance for young adults. The benefits of napping in older adults should be investigated because they have fragmented nocturnal sleep, cognitive declines, and more opportunity to nap. In addition, experience with napping might influence the benefits of napping. Study 1 examined the role of experience with napping in young adults. Habitual (n = 23) and non-habitual nappers (n = 16) were randomly assigned to a 20-minute nap or a 20- minute reading condition. Both groups slept the same according to macro architecture. However, microarchitecture showed greater theta, alpha, and beta power during Stage 1, and greater delta, alpha, and sigma power during Stage 2 for habitual nappers, for the most part indicating better sleep. Both groups felt less sleepy after the nap. P2 latency, reflecting information processing, decreased after the nap for habitual nappers, and after the control condition for non-habitual nappers. In sum, both groups who slept felt better, but only the habitual nappers who napped gained a benefit in terms of information processing. Based on this outcome, experience with napping was investigated in Study 2. Study 2 examined the extent to which daytime napping enhanced cognition in older adults, especially frontal lobe function. Cognitive deficits in older adults may be due to sleep loss and age-related decline in brain functioning. Longer naps were expected to provide greater improvement, particularly for older adults, by reducing sleep pressure. Thirty-two adults, aged 24-70 years, participated in a repeated measures dose-response manipulation of sleep pressure. Twenty- and sixty-minute naps were compared to a no-nap condition in three age groups. Mood, subjective sleepiness, reaction time, working memory, 11 novelty detection, and waking electro physiological measures were taken before and after each condition. EEG was also recorded during each nap or rest condition. Napping reduced subjective sleepiness, improved working memory (serial addition / subtraction task), and improved attention (reduced P2 amplitude). Physiological sleepiness (i.e., waking theta power) increased following the control condition, and decreased after the longer nap. Increased beta power after the short nap, and seen with older adults overall, may have reflected increased mental effort. Older adults had longer latencies and smaller amplitudes for several event-related potential components, and higher beta and gamma power. Following the longer nap, gamma power decreased for older adults, but increased for young adults. Beta and gamma power may represent enhanced alertness or mental effort. In addition, Nl amplitude showed that benefits depend on the preceding nap length as well as age. Since the middle group had smaller Nl amplitudes following the short nap and rest condition, it is possible that they needed a longer nap to maintain alertness. Older adults did not show improvements to Nl amplitude following any condition; they may have needed a nap longer than 60 minutes to gain benefits to attention or early information processing. Sleep characteristics were not related to benefits of napping. Experience with napping was also investigated. Subjective data confirmed habitual nappers were happier to nap, while non-habitual nappers were happier to stay awake, reflecting self-identified napping habits. Non-habitual nappers were sleepier after a nap, and had faster brain activity (i.e., heightened vigilance) at sleep onset. These reasons may explain why non-habitual nappers choose not to nap.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Il est reconnu, depuis une centaine d’années, que des désordres de la coagulation, regroupés sous le terme de coagulopathies, sont souvent associés au développement néoplasique. Pendant de nombreuses années, ces coagulopathies furent souvent reconnues comme une simple conséquence du développement du cancer. D’ailleurs, pour les cliniciens, l’apparition de ces anomalies sanguines constitue souvent le premier signe clinique d’un cancer occulte. Toutefois, l’étude approfondie du lien existant entre le système hémostatique et le cancer indique que différents facteurs hémostatiques vont interagir avec soit l’environnement tumoral ou soit la tumeur elle-même et influencer le développement du cancer. Au cours de nos travaux, nous avons porté une attention particulière à deux protéines jouant un rôle primordial dans l’hémostase. Le facteur tissulaire (TF) et l’inhibiteur du facteur tissulaire (TFPI) peuvent jouer des rôles pro- ou anti-néoplasique, et ce indépendamment de leurs fonctions hémostatiques normales. Dans le premier volet de cette thèse, nous avons étudié les propriétés antiangiogéniques de TFPI. L’angiogenèse, soit la formation de nouveaux vaisseaux sanguins à partir du réseau pré-existant, est reconnue comme étant une étape clée du développement tumoral. D’après nos travaux, le TFPI peut inhiber la formation de structures de type capillaire des cellules endothéliales (CEs) de la veine ombilicale humaine (HUVEC), et ce à une IC 50 de 5 nM, soit la concentration physiologique de l’inhibiteur. De plus, le TFPI bloque la migration des cellules endothéliales lorsque ces dernières sont stimulées par la sphingosine-1-phosphate (S1P), une molécule relâchée lors de l’activation des plaquettes sanguines. Cette inhibition de la migration cellulaire s’explique par l’effet du TFPI sur l’adhésion des CEs. En effet, TFPI inhibe la phosphorylation de deux protéines clées participant à la formation des complexes d’adhésion focales soit FAK (focal adhesion kinase) et PAX (paxilin). L’inhibition de ces deux protéines suggère qu’il y ait une réorganisation des complexes focaux, pouvant expliquer la perte d’adhérence. Finalement, des études de microscopie confocale démontrent que les cellules traitées au TFPI changent de morphologie au niveau du cytosquelette d’actine provoquant une désorganisation des structures migratoires (pseudopodes). Les effets du TFPI au niveau de la migration, de l’adhésion et de la morphologie cellulaire sont strictement spécifiques aux cellules endothéliales humaines, puisque aucun n’effet n’est observé en traitant des cellules cancéreuses de glioblastomes (GB) humains, qui sont normalement des tumeurs hautement vascularisées. En résumé, cette première étude démontre que le TFPI est un inhibiteur de l’angiogenèse. Dans le second volet de cette thèse, nous nous sommes intéressés aux différents rôles de TF, le principal activateur de la coagulation. Cette protéine est également impliquée dans le développement néoplasique et notamment celui des médulloblastomes (MB) chez l’enfant via des fonctions hémostatiques et non-hémostatiques. Nos travaux démontrent que l’expression de TF est induite par la voie de signalisation de HGF (hepatocyte growth factor) et de son récepteur Met. Cet effet de HGF/Met semble spécifique aux MB puisque HGF ne peut stimuler l’expression de TF au niveau des cellules cancéreuses de glioblastomes. TF, exprimé à la surface des cellules médulloblastiques (DAOY), est responsable de l’activité pro-thrombogénique de ces cellules, ainsi qu’un acteur important de la migration de ces cellules en réponse au facteur VIIa (FVIIa). De plus, en étudiant 18 spécimens cliniques de MB, nous avons établi un lien entre l’intensité d’expression de TF et de Met. L’importance de cette corrélation est également suggérée par l’observation que les cellules exprimant les plus forts taux de TF et de Met sont également les plus agressives en termes d’index de prolifération et de dissémination métastatiques. En résumé, ces travaux représentent le point de départ pour la mise au point de TF comme un marqueur diagnostique clinique dans les cas de tumeurs du cerveau pédiatriques. De plus, l’élucidation de la voie de signalisation moléculaire responsable de l’expression de TF permet de mieux comprendre la biologie et le fonctionnement de ces tumeurs et de relier le profil d’expression de TF aux phénotypes agressifs de la maladie. Il est reconnu que HGF peut également jouer un rôle protecteur contre l’apoptose. Dans le troisième volet de cette thèse, nous avons remarqué que cette protection est corrélée à l’expression de TF. En réduisant à néant l’expression de TF à l’aide de la technologie des ARN silencieux (siRNA), nous démontrons que HGF ne protège plus les cellules contre l’apoptose. Donc, TF médie l’activité anti-apoptotique de HGF. TF assume cette protection en inactivant la phosphorylation de p53 sur la sérine 15, empêchant ainsi la translocation de p53 au noyau. Finalement, l’expression de TF et son interaction avec le FVIIa, au niveau des cellules médulloblastiques favorise la survie de ces dernières et ce même si elles sont soumises à de fortes concentrations de médicaments couramment utilisées en cliniques. Ce troisième et dernier volet démontre l’implication de TF en tant que facteur impliqué dans la survie des cellules cancéreuses, favorisant ainsi le développement de la tumeur. Dans son ensemble, cette thèse vise à démontrer que les facteurs impliqués normalement dans des fonctions hémostatiques (TFPI et TF) peuvent contribuer à réguler le développement tumoral. Tout système physiologique et pathologique est dépendant d’un équilibre entre activateur et inhibiteur et la participation de TF et de TFPI à la régulation du développement néoplasique illustre bien cette balance délicate. Par sa contribution anti- ou pro-néoplasique le système hémostatique constitue beaucoup plus qu’une simple conséquence du cancer; il fait partie par l’action de TF des stratégies élaborées par les cellules cancéreuses pour assurer leur croissance, leur déplacement et leur survie, alors que TFPI tente de limiter la croissance tumorale en diminuant la vascularisation.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Nous avons récemment démontré que les espèces réactives oxygénées induisent une augmentation de l’expression des protéines Giα dans les cellules du muscle lisse vasculaire (CMLV) provenant d’aortes de rats spontanément hypertendus (SHR, de l’anglais spontaneously hypertensive rats). La présente étude a pour but d’étudier les effets du peroxyde d’hydrogène (H2O2), un oxydant qui induit le stress oxydatif, sur l’expression de Giα et sur l’activité de l’adénylate cyclase, et d’explorer les voies de signalisation sous-jacentes responsables de cette réponse. Nos résultats montrent que H2O2 induit une augmentation de l’expression des protéines Giα-2 et Giα-3 de manière dose- et temps-dépendante avec une augmentation maximale de 40-50% à 100 µM après 1 heure, sans affecter l’expression de Gsα. L’expression des protéines Giα a été maintenue au niveau normal en presence de AG 1478, AG1295, PD98059 et la wortmannine, des inhibiteurs d’EGF-R (de l’anglais epidermal growth factor receptor), PDGFR-β (de l’anglais platelet-derived growth factor receptor β), de la voie de signalisation ras-ERK1/2 (de l’anglais extracellular regulated kinase1/2), et de la voie de la PI3Kinase-AKT (de l’anglais phosphatidyl inositol-3 kinase), respectivement. En outre, le traitement des CMLV avec H2O2 a induit une augmentation du degré de phosphorylation d’EGF-R, PDGF-R, ERK1/2 et AKT; et cette expression a été maintenue au niveau témoin par leurs inhibiteurs respectifs. Les inhibiteurs d’EGF-R et PDGF-R ont aussi induit une diminution du degré de phosphorylation de ERK1/2, et AKT/PKB. En outre, la transfection des cellules avec le siRNA (de l’anglais, small interfering ribonucleic acid) de EGF-R et PDGFR-β a atténué la surexpression des protéines Giα-2 et Giα-3 induite par le traitement au H2O2. La surexpression des protéines Giα induite par H2O2 a été corrélée avec une augmentation de la fonction de la protéine Giα. L’inhibition de l’activité de l’adénylate cyclase par de faibles concentrations de GTPγS après stimulation par la forskoline a augmenté de 20% dans les cellules traitées au H2O2. En outre, le traitement des CMLV au H2O2 a aussi accru l’inhibition de l’activité de l’adénylate cyclase par les hormones inhibitrices telles que l’angiotensine II, oxotrémorine et C-ANP4-23. D’autre part, la stimulation de l’adénylate cyclase induite par GTPγS, glucagon, isoprotérénol, forskoline, et le fluorure de sodium (NaF) a été atténuée de façon significative dans les cellules traitées au H2O2. Ces résultats suggèrent que H2O2 induit la surexpression des protéines Giα-2 and Giα-3 via la transactivation des récepteurs des facteurs de croissance EGF-R, PDGFR-β et l’activation des voies de signalisation ras-ERK1/2 et PI3K-AKT Mot-cles: Protéines Giα, peroxyde d’hydrogène, stress oxydant, récepteurs des facteurs de croissance, MAP kinases, adénylate cyclase, hypertension