Metodologia para re-sintonia de controladores PID industriais

The present work has as objective to present a method of project and implementation of controllers PID, based on industrial instrumentation. An automatic system of auto-tunning of controllers PID will be presented, for systems of first and second order. The software presented in this work is applied in controlled plants by PID controllers implemented in a CLP. Software is applied to make the auto-tunning of the parameters of controller PID of plants that need this tunning. Software presents two stages, the first one is the stage of identification of the system using the least square recursive algorithm and the second is the stage of project of the parameters of controller PID using the root locus algorithm. An important fact of this work is the use of industrial instrumentation for the accomplishment of the experiments. The experiments had been carried through in controlled real plants for controllers PID implemented in the CLP. Thus has not only one resulted obtained with theoreticians experiments made with computational programs, and yes resulted obtained of real systems. The experiments had shown good results gotten with developed software

Uma proposta de metodologia para o ensino de Física usando robótica de baixíssimo custo

This paper presents methodology based on Lev Vigotsky`s social interactionist theory through investigative activities, which integrates the teaching of physics to robotics, directed to students of the Physics degree course, seeking to provide further training for future teachers. The method is organized through educational robotics workshops that addresses concepts of physics through the use of low-cost educational robots along with several activities. The methodology has been presented and discussed and put into practice afterwards in workshops so that these future teachers may be able to take robotics to their classroom. Students from the last and penultimate semester of the Physics degree course of the Federal Institute of Education, Science and Technology of Rio Grande do Norte, Caicó campus participated in this project

Painéis-sanduíche com núcleo de EPS reciclado: metodologia de execução e determinação de propriedades termofísicas

New materials made from industrial wastes have been studied as an alternative to traditional fabrication processes in building and civil engineering. These materials are produced considering some issues like: cost, efficiency and reduction of nvironmental damage. Specifically in cases of materials destined to dwellings in low latitude regions, like Brazilian Northeast, efficiency is related to mechanical and thermal resistance. Thus, when thermal insulation and energetic efficiency are aimed, it s important to increase thermal resistance without depletion of mechanical properties. This research was conducted on a construction element made of two plates of cement mortar, interspersed with a plate of recycled expanded polystyrene (EPS). This component, widely known as sandwich-panel, is commonly manufactured with commercial EPS whose substitution was proposed in this study. For this purpose it was applied a detailed methodology that defines parameters to a rational batching of the elements that constitute the nucleus. Samples of recycled EPS were made in two different values of apparent specific mass (ρ = 65 kg/m³; ρ = 130 kg/m³) and submitted to the Quick-Line 30TM that is a thermophysical properties analyzer. Based on the results of thermal conductivity, thermal capacity and thermal diffusivity obtained, it was possible to assure that recycled EPS has thermal insulation characteristics that qualify it to replace commercial EPS in building and civil engineering industry

Metodologia de análise e diagnóstico de fratura em um componente automotivo sujeito a cargas cíclicas alternadas

The competitiveness of the trade generated by the higher availability of products with lower quality and cost promoted a new reality of industrial production with small clearances. Track deviations at the production are not discarded, uncertainties can statistically occur. The world consumer and the Brazilian one are supported by the consumer protection code, in lawsuits against the products poor quality. An automobile is composed of various systems and thousands of constituent parts, increasing the likelihood of failure. The dynamic and security systems are critical in relation to the consequences of possible failures. The investigation of the failure gives us the possibility of learning and contributing to various improvements. Our main purpose in this work is to develop a systematic, specific methodology by investigating the root cause of the flaw occurred on an axle end of the front suspension of an automobile, and to perform comparative data analyses between the fractured part and the project information. Our research was based on a flaw generated in an automotive suspension system involved in a mechanical judicial cause, resulting in property and personal damages. In the investigations concerning the analysis of mechanical flaws, knowledge on materials engineering plays a crucial role in the process, since it enables applying techniques for characterizing materials, relating the technical attributes required from a respective part with its structure of manufacturing material, thus providing a greater scientific contribution to the work. The specific methodology developed follows its own flowchart. In the early phase, the data in the records and information on the involved ones were collected. The following laboratory analyses were performed: macrography of the fracture, micrography with SEM (Scanning Electron Microscope) of the initial and final fracture, phase analysis with optical microscopy, Brinell hardness and Vickers microhardness analyses, quantitative and qualitative chemical analysis, by using X-ray fluorescence and optical spectroscopy for carbon analysis, qualitative study on the state of tension was done. Field data were also collected. In the analyses data of the values resulting from the fractured stock parts and the design values were compared. After the investigation, one concluded that: the developed methodology systematized the investigation and enabled crossing data, thus minimizing diagnostic error probability, the morphology of the fracture indicates failure by the fatigue mechanism in a geometrically propitious location, a tension hub, the part was subjected to low tensions by the sectional area of the final fracture, the manufacturing material of the fractured part has low ductility, the component fractured in an earlier moment than the one recommended by the manufacturer, the percentages of C, Si, Mn and Cr of the fractured part present values which differ from the design ones, the hardness value of the superior limit of the fractured part is higher than that of the design, and there is no manufacturing uniformity between stock and fractured part. The work will contribute to optimizing the guidance of the actions in a mechanical engineering judicial expertise

Metodologia, Sistema de Codificação e Ferramenta de software para Modelagem de Móveis Modulados

On this research we investigated how new technologies can help the process of design and manufacturing of furniture in such small manufacturers in Rio Grande do Norte state. Google SketchUp, a 3D software tool, was developed in such a way that its internal structures are opened and can be accessed using SketchUp s API for Ruby and programs written in Ruby language (plugins). Using the concepts of the so-called Group Technology and the flexibility that enables adding new functionalities to this software, it was created a Methodology for Modeling of Furniture, a Coding System and a plugin for Google s tool in order to implement the Methodology developed. As resulted, the following facilities are available: the user may create and reuse the library s models over-and-over; reports of the materials manufacturing process costs are provided and, finally, detailed drawings, getting a better integration between the furniture design and manufacturing process

Validação de uma metodologia de ensaio de resistência ao cisalhamento para avaliação da aderência de interfaces revestimento metálico-bainha de cimento aplicada a poços de petróleo

Improving the adherence between oilwell metallic casing and cement sheath potentially decrease the number of corrective actions present/y necessary for Northeastern wells submitted to steam injection. In addition to the direct costs involved in the corrective operations, the economic impact of the failure of the primary cementing aIso includes the loss in the production of the well. The adherence between casing and cement is current/y evaluated by a simple shear tests non standardized by the American Petroleum Institute (API). Therefore, the objective of the present is to propose and evaluate a standardized method to assess the adherence of oilwell metallic casing to cement sheath. To that end, a section of a cemented oilwell was simulated and used to test the effect of different parameters on the shear stress of the system. Surface roughness and different cement compositions submitted or not to thermal cycling were evaluated. The results revealed that the test geometry and parameters proposed yielded different values for the shear stress of the system, corresponding to different adherent conditions between metallic casing and cement sheath

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Comparação da precisão dos resultados do teste de tetrazolio usando a metodologia alternativa e a tradicional em sementes de soja

The use of tetrazolium testing is recognized in the soybean seed quality control due to the large amount of data which it provides. Although it is considered a quick test, in 1998 an alternative methodology was proposed for the seed preconditioning, which allows 10 hours of time saving in seeds preparation. The objective of this research is to compare the accuracy of the new and the traditional tetrazolium testing. Three soybean seed genotypes were used, Conquista, Garantia and M-soy 8400, all 2000/2001 crop. The seeds were evaluated in relation to germination, evaluated with the traditional (TZt) and the alternative (Tza) tetrazolium test as well as with the accelerated aging performed in two different conditions (45 degrees C 24h(-1) and 45 degrees C 72h(-1)). After aging, the seeds too were submitted to TZt and Tza testing. The experimental design was a randomized blocks, with four replicates the 50 seeds per genotype in every evaluation, with exception only for tetrazolium test, with two replicates. The averages were compared in the Tukey test level of 5% probability. The comparison between the two methodologies in relation to level of vigor (class 1 to 3) and germination potential (class 1 to 5) indicated no statistical discrepancies, for aged non-aged seeds. This, the use of the alternative tetrazolium test is recommend in case a reduced seed preparation time is needed.

Aplicação e análise de metodologia de deterioração ambiental em micro-bacia do seridó potiguar

In the contemporary world to the deterioration of semi-arid areas of the planet has been the focus of media attention and the scientific community. Brazil has a semiarid, considered the most problematic of the world, either by pressure from physical factors, whether as a result of misguided public policies, has over time been suffering from the consequences of a deterioration that expands over the years. Methodologies, that amidst the problems of semi-arid, come against the deteriorating local, have a good chance to be reapplied in other contexts around the world. This research, based on methodological model for analyzing environmental deterioration, introduced and examined the applicability of the methodology in the semi-arid region of Rio Grande do Norte - Brazil. Although the results provide guidelines for the introduction of underground dams, the application of the methodology was ineffective, given the high rates of forest cover that gave low values for the physical diagnosis conservationist

Efeitos da perda de peso induzida pela cirurgia bariátrica sobre a função respiratória

Background: Obesity leads to alteration of lung volumes and capacities due to accumulation of fat in the chest wall and abdomen. Few studies have shown that weight loss induced by surgery improves lung function. Our objective was to evaluate the anthropometric development, pulmonary function, respiratory muscle, strength and endurance after weight loss induced by bariatric surgery. Methods: We evaluated in pre and post operative period variables of weight, BMI, NC, WHR and spirometric and respiratory pressure. Results: 39 subjects were evaluated, with age mean 35.9 ± 10.9 years, predominantly by women (76.3%). The weight mean decreased from 124.8 ± 17.5 kg to 88.8 ± 14.28 kg in post operative. The mean BMI ranged from 47,9 ± 5,6 Kg/m² to 34,3 ± 4,75 Kg/m². There was a significant increase in FVC from 3,63 ± 0,94 to 4,01±1,03, FEV1 from 3,03 ± 0,72 to 3,39 ± 0,85, FEF 25-75% from 3,41 ± 0,72 to 3,82 ± 0,94, PEF from 6,56 ± 1,47 to 7,81 ± 1,69, ERV from 0,35 ± 0,39 to 0,66 ± 0,38, MVV ranged from 103,43 ± 22,21 to 137,27 ± 29,84, all of them to p<0,01. The MIP and MEP showed no significant difference in pre and post operative. It was noted that for every centimeter reduced in neck circumference, an increase of 0.06 in FVC and 5.98 in MVV is observed. This is also observed in weight and BMI. Conclusion: We conclude that weight loss induced by bariatric surgery in obese provides a significant improvement in lung function and reduction of fat around the neck is more important in the generation of lung volume than the reduction of BMI

Desfechos clínicos e mortalidade de sujeitos submetidos à cirurgia bariátrica no Rio Grande do Norte

Introduction: Actually the obesity is a public health problem throughout the world. Bariatric surgery has been an efficient method of weight reduction body in severe obesity, reducing its associated effects and presenting low levels of immediate and late postoperative complications. In Brazil, bariatric surgery asa recent therapeutic that has been growing recently. Being Brazil a country with continental dimensions and with a huge diversity socioeconomic and cultural, it is essential to understand the reality of patients undergoing bariatric surgery in less economically privileged regions of Brazil. Objectives: To evaluate the epidemiological, clinical outcomes and mortality of patients undergoing videolaparoscopic bariatric surgery through the public health system in the Brazilian state of Rio Grande do Norte- Brazil. Methods: Observational descriptive study of a prospective, carried out from February 2009 to February 2011, the Clinic Obesity and Bariatric Surgery at Universitary Hospital Onofre Lopes - Federal University of Rio Grande do Norte (HUOL-UFRN). Anthropometric measures, comorbidity and deaths register were made in the postoperative period. Results: Seventy patients (54 women) with low income aged 22 to 63 years completed the study. We recorded the death of three patients during the study period. The results show significant decrease anthropometric parameters, especially in relation to body weight, waist circumference and hipin both sexes. Only Waist / Hip ratio showed no difference after intervention in male patients It had a resolution of comorbidities. No significant differences in reports of daily sleepiness and the snoring male patients. Conclusion: Our findings attest laparoscopic bariatric surgery as an effective method reducing weight and comorbidities in morbidly obese patients

Metodologia para rastreamento com modificação dos zeros e rejeição de distúrbio aplicada a sistemas incertos

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Desenvolvimento de uma metodologia para caracterização de amostras de sedimento: Rio Jundiaí RN

The study of sediment in water bodies presents great environmental importance, because of its ability to adsorb the pollutants, they may facilitate the understanding of the history of the current quality of the water system. Depending on how it is done the collection, analysis can show both a recent contamination as old. The detailed characterization of the sediment may reveal details that can understand how each type of pollutant interacts with the material given its composition. In this work it has developed a systematic methodology to characterize samples of sediment, with the aim to understand how a series of metal is distributed in different size fractions of the sediment. This study was conducted in five samples of sediment (P1, P2, P3a, P3B and P3c) collected in Jundiaí river, one of the most important tributaries of the river Potengi in the region of Macaíba, RN. The characterization was made with the samples previously sieved into meshes with different granulometries (+8#, -8+16#, -16+65# - 65+100#,-100+200#,-200+250# and -250#), using the following techniques: Analysis of specific surface area by BET method, determining the levels of organic matter (OM%) and humidity through the gravimetry and Analysis Thermogravimetric (TG), Infrared Spectroscopy in a Fourier transform (FTIR ), Analysis of X ray diffraction (XRD), analysis of heavy metals by optical emission spectrometry with the Argon Plasma (ICP-OES). The analyzed elements were Al, Cd, Cr, Cu, Fe, Mn, Ni, Zn and P. In addition to the techniques of characterization above, was also made the rebuilding of the samples P1, P2 and P3B in relation to the levels of organic matter and concentration of heavy metals. Then, the results of the recomposed samples were compared with those obtained in crude samples, showing great consistency. The gravimetry, used in determining the levels of organic matter, was not considered an appropriate method because the clay minerals present in the sediment samples analyzed fall apart in the same range of temperature (550-600 0C) used in roasting (600 0C). The results also showed the trend of organic matter and heavy metals to focus on the thin fractions, although the largest concentrations of metals are in intermediate fractions

Considerações sobre metodologia interativa aplicada à disciplinas de química orgânica de alguns cursos da UFRN

The aiming of this work is linked to chemical education, focusing organic chemistry classes of Chemical Engineering, Pharmacy and Zootechny graduate courses of the Federal University of Rio Grande do Norte. For that, teaching-learning process related to basic chemical subjects which support the understanding of organic chemistry concepts was evaluated in a research period of two years. The education proposal linked to the theoretical content of the cited classes, pointed out the process of knowledge construction, in which educational commitment as well as dedication in the teaching-learning process was also valued. In that approach several didactic tools were applied, among them scientific articles were used as supplementary studies of the basic organic chemistry concepts and related. The acceptability of students, as well as their motivation, performance and learning process was justified by the data collection of the applied teaching methodology. The acceptability and commitment of the students facing this teaching interactive approach, which transversely contributed to the intellectual maturity growth of the students, as well their professional development, were evidenced by satisfactory obtained results that will be herein discussed

Validação de metodologia para análise de aminas bioativas em camarão utilizando cromatografia de íons

In this study, we worked with the validation of a methodology for analysis of bioactive amines in shrimp, considering it to be one of the main products of the northriograndense trade balance, maintaining the state of Rio Grande do Norte topped the list of Brazilian exports of this product the last decade. The sector of the Brazilian shrimp works exclusively with gray shrimp Litopenaeus Vannamei since the late 1990s. This study used liquid chromatography with conductimetric detector, using as the mobile phase methylsulfonic 3 mM acid (MSA) with gradient and phase C18 column with reverse the development of methodology for the analysis of bioactive amines in shrimp. In the sample preparation was used as 5% trichloroacetic acid (TCA) extraction solution. Validation analysis of biotativas amines (putrescine - PUT, histamine - HIST, agmatine - AGM, spermidine - EPD and spermine - EPN) in shrimp, the linear working range was 0.1 to 2.0 mg L-1 to was sensitive, homoscedastic, in effect, selective, accurate and precise array. Thus, considered feasible for these determinations bioactive amines in this array. Determined the concentration of these amines in fresh shrimps (AGM = 0.61 ± 0.05 mg kg- 1 EPD = 2.57 ± 0.14 mg kg-1 and EPN = 1.79 ± 0.11 mg kg-1), and freezing weather predetermined in cooked shrimp (AGM = 6.28 ± 0.18 mg kg-1, EPD = 12.72 ± 0.02 mg kg- 1 and EPN = 22.30 ± 0.60 mg kg-1), the shrimp with twenty-four hour stay at room temperature (PUT = 879.52 ± 28.12 mg kg-1, AGM = 848.13 ± 19.40 mg kg-1, ESPD = 13.59 ± 0.97 mg kg-1 and ESPN = 18.47 + 1.57 mg kg-1). In shrimp subjected to freezing for a week, two weeks, three weeks and four weeks, the results showed that there is an increase in the content of agmatine (7.31 ± 0.21 mg kg-1) while in spermine ( 1.22 ± 0.14 mg kg-1) and spermidine (below limit of quantification) there was a decrease in the freeze time, while there is a decrease in the level of spermidine not reaching detectad. The putrescine was only found in shrimp that remained for 24 hours at room temperature and histamine was not found in any of the samples