Taurine inhibits serum deprivation-induced osteoblast apoptosis via the taurine transporter/ERK signaling pathway

Taurine has positive effects on bone metabolism. However, the effects of taurine on osteoblast apoptosis in vitro have not been reported. The aim of this study was to investigate the activity of taurine on apoptosis of mouse osteoblastic MC3T3-E1 cells. The data showed that 1, 5, 10, or 20 mM taurine resulted in 16.7, 34.2, 66.9, or 63.75% reduction of MC3T3-E1 cell apoptosis induced by the serum deprivation (serum-free α-MEM), respectively. Taurine (1, 5, or 10 mM) also reduced cytochrome c release and inhibited activation of caspase-3 and -9, which were measured using fluorogenic substrates for caspase-3/caspase-9, in serum-deprived MC3T3-E1 cells. Furthermore, taurine (10 mM) induced extracellular signal-regulated kinase (ERK) phosphorylation in MC3T3-E1 cells. Knockdown of the taurine transporter (TAUT) or treatment with the ERK-specific inhibitor PD98059 (10 μM) blocked the activation of ERK induced by taurine (10 mM) and abolished the anti-apoptotic effect of taurine (10 mM) in MC3T3-E1 cells. The present results demonstrate for the first time that taurine inhibits serum deprivation-induced osteoblast apoptosis via the TAUT/ERK signaling pathway.

Psychological stress alters the ultrastructure and increases IL-1β and TNF-α in mandibular condylar cartilage

Psychological factors can be correlated with temporomandibular disorders (TMDs), but the mechanisms are unknown. In the present study, we examined the microstructural changes and expression of proinflammatory cytokines in mandibular condylar cartilage of the temporomandibular joint (TMJ) in a psychological stress animal model. Male Sprague-Dawley rats (8 weeks old, 210 ± 10 g) were randomly divided into 3 groups: psychological stress (PS, N = 48), foot shock (FS, N = 24), and control (N = 48). After inducing psychological stress using a communication box with the FS rats for 1, 3, or 5 weeks, PS rats were sacrificed and compared to their matched control littermates, which received no stress and were killed at the same times as the PS rats. Body and adrenal gland weight were measured and corticosterone and adrenocorticotropic hormone levels were determined by radioimmunoassay. After hematoxylin-eosin staining for histological observation, the ultrastructure of the TMJ was examined by scanning electron microscopy. Transcription and protein levels of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) were evaluated by ELISA and semi-quantitative RT-PCR. The PS group showed a significantly higher adrenal gland weight after 3 weeks of stress and higher hormone levels at weeks 1, 3, and 5. Histopathological changes and thinning cartilage were apparent at weeks 3 and 5. In the PS group, TNF-α increased at 1, 3, and 5 weeks and IL-1β increased significantly after 1 and 3 weeks of stress, and then decreased to normal levels by 5 weeks. Psychological stress increased plasma hormone levels and RT-PCR indicated increased IL-1β and TNF-α expression in the TMJ in a time-dependent manner. These results suggest that cytokine up-regulation was accompanied by stress-induced cartilage degeneration in the mandibular condyle. The proinflammatory cytokines play a potential role in initiating the cartilage destruction that eventually leads to the TMDs.

Diastolic function is associated with quality of life and exercise capacity in stable heart failure patients with reduced ejection fraction

Exercise capacity and quality of life (QOL) are important outcome predictors in patients with systolic heart failure (HF), independent of left ventricular (LV) ejection fraction (LVEF). LV diastolic function has been shown to be a better predictor of aerobic exercise capacity in patients with systolic dysfunction and a New York Heart Association (NYHA) classification ≥II. We hypothesized that the currently used index of diastolic function E/e' is associated with exercise capacity and QOL, even in optimally treated HF patients with reduced LVEF. This prospective study included 44 consecutive patients aged 55±11 years (27 men and 17 women), with LVEF<0.50 and NYHA functional class I-III, receiving optimal pharmacological treatment and in a stable clinical condition, as shown by the absence of dyspnea exacerbation for at least 3 months. All patients had conventional transthoracic echocardiography and answered the Minnesota Living with HF Questionnaire, followed by the 6-min walk test (6MWT). In a multivariable model with 6MWT as the dependent variable, age and E/e' explained 27% of the walked distance in 6MWT (P=0.002; multivariate regression analysis). No association was found between walk distance and LVEF or mitral annulus systolic velocity. Only normalized left atrium volume, a sensitive index of diastolic function, was associated with decreased QOL. Despite the small number of patients included, this study offers evidence that diastolic function is associated with physical capacity and QOL and should be considered along with ejection fraction in patients with compensated systolic HF.

Fluorescent quantitative PCR of Mycobacterium tuberculosis for differentiating intestinal tuberculosis from Crohn's disease

Intestinal tuberculosis (ITB) and Crohn's disease (CD) are granulomatous disorders with similar clinical manifestations and pathological features that are often difficult to differentiate. This study evaluated the value of fluorescent quantitative polymerase chain reaction (FQ-PCR) for Mycobacterium tuberculosis (MTB) in fecal samples and biopsy specimens to differentiate ITB from CD. From June 2010 to March 2013, 86 consecutive patients (38 females and 48 males, median age 31.3 years) with provisional diagnoses of ITB and CD were recruited for the study. The patients' clinical, endoscopic, and histological features were monitored until the final definite diagnoses were made. DNA was extracted from 250 mg fecal samples and biopsy tissues from each patient. The extracted DNA was amplified using FQ-PCR for the specific MTB sequence. A total of 29 ITB cases and 36 CD cases were included in the analysis. Perianal disease and longitudinal ulcers were significantly more common in the CD patients (P<0.05), whereas night sweats, ascites, and circumferential ulcers were significantly more common in the ITB patients (P<0.05). Fecal FQ-PCR for MTB was positive in 24 (82.8%) ITB patients and 3 (8.3%) CD patients. Tissue PCR was positive for MTB in 16 (55.2%) ITB patients and 2 (5.6%) CD patients. Compared with tissue FQ-PCR, fecal FQ-PCR was more sensitive (X2=5.16, P=0.02). We conclude that FQ-PCR for MTB on fecal and tissue samples is a valuable assay for differentiating ITB from CD, and fecal FQ-PCR has greater sensitivity for ITB than tissue FQ-PCR.

Single nucleotide polymorphisms predisposing to asthma in children of Mauritian Indian and Chinese Han ethnicity

Our objective was to investigate the distributions of six single nucleotide polymorphisms (SNPs) MS4A2 E237G, MS4A2 C-109T, ADRB2 R16G, IL4RA I75V,IL4 C-590T, and IL13 C1923T in Mauritian Indian and Chinese Han children with asthma. This case-control association study enrolled 382 unrelated Mauritian Indian children, 193 with asthma and 189 healthy controls, and 384 unrelated Chinese Han children, 192 with asthma and 192 healthy controls. The SNP loci were genotyped using polymerase chain reaction (PCR)-restriction fragment length polymorphism for the Chinese Han samples and TaqMan real-time quantitative PCR for the Mauritian Indian samples. In the Mauritian Indian children, there was a significant difference in the distribution of IL13 C1923T between the asthma and control groups (P=0.033). The frequency of IL13 C1923T T/T in the Mauritian Indian asthma group was significantly higher than in the control group [odds ratio (OR)=2.119, 95% confidence interval=1.048-4.285]. The Chinese Han children with asthma had significantly higher frequencies ofMS4A2 C-109T T/T (OR=1.961, P=0.001) and ADRB2 R16G A/A (OR=2.575, P=0.000) than the control group. The IL13 C1923T locus predisposed to asthma in Mauritian Indian children, which represents an ethnic difference from the Chinese Han population. TheMS4A2 C-109T T/T and ADRB2 R16G A/Agenotypes were associated with asthma in the Chinese Han children.

Advanced glycation end products (AGEs) and their receptor (RAGE) induce apoptosis of periodontal ligament fibroblasts

Diabetics have an increased prevalence of periodontitis, and diabetes is one of the causative factors of severe periodontitis. Apoptosis is thought to be involved in this pathogenic relationship. The aim of this study was to investigate apoptosis in human periodontal ligament (PDL) fibroblasts induced by advanced glycation end products (AGEs) and their receptor (RAGE). We examined the roles of apoptosis, AGEs, and RAGE during periodontitis in diabetes mellitus using cultured PDL fibroblasts that were treated by AGE-modified bovine serum albumin (AGE-BSA), bovine serum albumin (BSA) alone, or given no treatment (control). Microscopy and real-time quantitative PCR indicated that PDL fibroblasts treated with AGE-BSA were deformed and expressed higher levels of RAGE and caspase 3. Cell viability assays and flow cytometry indicated that AGE-BSA reduced cell viability (69.80±5.50%, P<0.01) and increased apoptosis (11.31±1.73%, P<0.05). Hoechst 33258 staining and terminal-deoxynucleotidyl transferase-mediated nick-end labeling revealed that AGE-BSA significantly increased apoptosis of PDL fibroblasts. The results showed that the changes in PDL fibroblasts induced by AGE-BSA may explain how AGE-RAGE participates in and exacerbates periodontium destruction.

Factors associated with Clostridium difficile diarrhea in a hospital in Beijing, China

Clostridium difficile is the most common cause of hospital-acquired diarrhea in patients treated with antibiotics, chemotherapeutic agents, and other drugs that alter the normal equilibrium of the intestinal flora. A better understanding of the risk factors for C. difficile-associated disease (CDAD) could be used to reduce the incidence of CDAD and the costs associated with its treatment. The aim of this study was to identify the risk factors for CDAD in a cohort of Chinese patients in a Beijing hospital. Medical charts of a total of 130 inpatients (62 males and 68 females) with hospital-acquired diarrhea (45 with CDAD; 85 without CDAD) were retrospectively reviewed. C. difficile toxins A and B were detected in fecal samples using enzyme-linked fluorescence assays. The drugs used by patients with and without CDAD before the onset of diarrhea were compared. Factors that differed significantly between the two groups by univariate analysis were analyzed by multivariate analysis using a logistic regression model. Multivariate analysis showed that cephalosporin treatment was associated with a significantly higher risk of CDAD in hospitalized patients, while treatment with glycopeptides was significantly associated with a reduction in CDAD (P<0.001 for cephalosporin; P=0.013 for glycopeptides). Our data confirmed previous findings that empirical treatment with cephalosporins is positively associated with CDAD compared to individuals using other CDAD-related drugs. Additionally, we showed that treatment with glycopeptides was negatively associated with CDAD, compared to individuals using other CDAD-related drugs.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Early neonatal echocardiographic findings in an experimental rabbit model of congenital diaphragmatic hernia

This study aimed to demonstrate that congenital diaphragmatic hernia (CDH) results in vascular abnormalities that are directly associated with the severity of pulmonary hypoplasia and hypertension. These events increase right ventricle (RV) afterload and may adversely affect disease management and patient survival. Our objective was to investigate cardiac function, specifically right ventricular changes, immediately after birth and relate them to myocardial histological findings in a CDH model. Pregnant New Zealand rabbits underwent the surgical procedure at 25 days of gestation (n=14). CDH was created in one fetus per horn (n=16), and the other fetuses were used as controls (n=20). At term (30 days), fetuses were removed, immediately dried and weighed before undergoing four-parameter echocardiography. The lungs and the heart were removed, weighed, and histologically analyzed. CDH animals had smaller total lung weight (P<0.005), left lung weight (P<0.005), and lung-to-body ratio (P<0.005). Echocardiography revealed a smaller left-to-right ventricle ratio (LV/RV, P<0.005) and larger diastolic right ventricle size (DRVS, P<0.007). Histologic analysis revealed a larger number of myocytes undergoing mitotic division (186 vs 132, P<0.05) in CDH hearts. Immediate RV dilation of CDH hearts is related to myocyte mitosis increase. This information may aid the design of future strategies to address pulmonary hypertension in CDH.

Protective effects of tumor necrosis factor-α blockade by adalimumab on articular cartilage and subchondral bone in a rat model of osteoarthritis

We aimed to investigate the effects of an anti-tumor necrosis factor-α antibody (ATNF) on cartilage and subchondral bone in a rat model of osteoarthritis. Twenty-four rats were randomly divided into three groups: sham-operated group (n=8); anterior cruciate ligament transection (ACLT)+normal saline (NS) group (n=8); and ACLT+ATNF group (n=8). The rats in the ACLT+ATNF group received subcutaneous injections of ATNF (20 μg/kg) for 12 weeks, while those in the ACLT+NS group received NS at the same dose for 12 weeks. All rats were euthanized at 12 weeks after surgery and specimens from the affected knees were harvested. Hematoxylin and eosin staining, Masson's trichrome staining, and Mankin score assessment were carried out to evaluate the cartilage status and cartilage matrix degradation. Matrix metalloproteinase (MMP)-13 immunohistochemistry was performed to assess the cartilage molecular metabolism. Bone histomorphometry was used to observe the subchondral trabecular microstructure. Compared with the rats in the ACLT+NS group, histological and Mankin score analyses showed that ATNF treatment reduced the severity of the cartilage lesions and led to a lower Mankin score. Immunohistochemical and histomorphometric analyses revealed that ATNF treatment reduced the ACLT-induced destruction of the subchondral trabecular microstructure, and decreased MMP-13 expression. ATNF treatment may delay degradation of the extracellular matrix via a decrease in MMP-13 expression. ATNF treatment probably protects articular cartilage by improving the structure of the subchondral bone and reducing the degradation of the cartilage matrix.

Implantation of muscle satellite cells overexpressing myogenin improves denervated muscle atrophy in rats

This study evaluated the effect of muscle satellite cells (MSCs) overexpressing myogenin (MyoG) on denervated muscle atrophy. Rat MSCs were isolated and transfected with the MyoG-EGFP plasmid vector GV143. MyoG-transfected MSCs (MTMs) were transplanted into rat gastrocnemius muscles at 1 week after surgical denervation. Controls included injections of untransfected MSCs or the vehicle only. Muscles were harvested and analyzed at 2, 4, and 24 weeks post-transplantation. Immunofluorescence confirmed MyoG overexpression in MTMs. The muscle wet weight ratio was significantly reduced at 2 weeks after MTM injection (67.17±6.79) compared with muscles injected with MSCs (58.83±5.31) or the vehicle (53.00±7.67; t=2.37, P=0.04 and t=3.39, P=0.007, respectively). The muscle fiber cross-sectional area was also larger at 2 weeks after MTM injection (2.63×103±0.39×103) compared with MSC injection (1.99×103±0.58×103) or the vehicle only (1.57×103±0.47×103; t=2.24, P=0.049 and t=4.22, P=0.002, respectively). At 4 and 24 weeks post-injection, the muscle mass and fiber cross-sectional area were similar across all three experimental groups. Immunohistochemistry showed that the MTM group had larger MyoG-positive fibers. The MTM group (3.18±1.13) also had higher expression of MyoG mRNA than other groups (1.41±0.65 and 1.03±0.19) at 2 weeks after injection (t=2.72, P=0.04). Transplanted MTMs delayed short-term atrophy of denervated muscles. This approach can be optimized as a novel stand-alone therapy or as a bridge to surgical re-innervation of damaged muscles.

Differentiating origins of outflow tract ventricular arrhythmias: a comparison of three different electrocardiographic algorithms

Our objective is to evaluate the accuracy of three algorithms in differentiating the origins of outflow tract ventricular arrhythmias (OTVAs). This study involved 110 consecutive patients with OTVAs for whom a standard 12-lead surface electrocardiogram (ECG) showed typical left bundle branch block morphology with an inferior axis. All the ECG tracings were retrospectively analyzed using the following three recently published ECG algorithms: 1) the transitional zone (TZ) index, 2) the V2 transition ratio, and 3) V2 R wave duration and R/S wave amplitude indices. Considering all patients, the V2 transition ratio had the highest sensitivity (92.3%), while the R wave duration and R/S wave amplitude indices in V2 had the highest specificity (93.9%). The latter finding had a maximal area under the ROC curve of 0.925. In patients with left ventricular (LV) rotation, the V2 transition ratio had the highest sensitivity (94.1%), while the R wave duration and R/S wave amplitude indices in V2 had the highest specificity (87.5%). The former finding had a maximal area under the ROC curve of 0.892. All three published ECG algorithms are effective in differentiating the origin of OTVAs, while the V2 transition ratio, and the V2 R wave duration and R/S wave amplitude indices are the most sensitive and specific algorithms, respectively. Amongst all of the patients, the V2 R wave duration and R/S wave amplitude algorithm had the maximal area under the ROC curve, but in patients with LV rotation the V2 transition ratio algorithm had the maximum area under the ROC curve.

Qualidade pós-colheita do tomate de mesa convencional e orgânico

O presente trabalho teve como objetivo avaliar a qualidade pós-colheita de frutos de tomate de mesa de diferentes sistemas de cultivos. As amostras de tomate convencional, cv. Raísa (LV), e orgânico, cv. Santa Clara, foram mantidas a uma temperatura de 23,5 ± 2 ºC, com UR de 74% ± 5 e submetidas a análise da massa, peso específico, cinzas, sólidos totais, sólidos solúveis totais, acidez titulável total, relação sólidos solúveis totais/acidez titulável total, pH, vitamina C, Salmonella spp., coliformes totais, coliformes fecais, bolores e leveduras e análise sensorial, que foi realizada pela Análise Descritiva Quantitativa - ADQ. O tempo de armazenagem foi de 13 e 14 dias para o tomate de mesa cultivado nos sistemas convencional e orgânico, respectivamente. O tempo de armazenagem foi de 13 e 14 dias para o tomate de mesa cultivado nos sistemas convencional e orgânico, respectivamente. A perda de massa foi significativamente inferior (3,74%) no tomate convencional. Ambas as amostras apresentaram similar comportamento na análise física, química sensorial e microbiológica nos estádios de maturação

Oxidative stability of cereal bars made with fruit peels and baru nuts packaged in different types of packaging

Food industries have been concerned about managing the waste generated by their production processes in order to minimize environmental impacts and also about the development of formulations with different and innovative ingredients such as fruits from the Brazilian savanna. Seeking to meet the expectations of consumers who desire healthy and practical products, this study aimed to evaluate the oxidative stability and the variations in chemical composition and antioxidant potential of cereal bars made with fruit peels and baru nuts packaged in different types of packaging. The bars formulated were packed in four different types of packaging: laminated without vacuum (LWV), transparent without vacuum (TWV), transparent under vacuum (TV), and laminated under vacuum (LV); they were subsequently analyzed for proximate composition, fatty acid profiles, antioxidant activity, and oxidative capacity. The results showed that the cereal bars made with fruit peel and baru are sources of protein, dietary fiber, and fat, especially unsaturated fatty acids such as oleic and linoleic acids. The cereal bars exhibited oxidative stability up to 120 days of storage, and the type of packaging was not significant for the variables evaluated; therefore, they can be stored in low cost packaging such as transparent packaging without vacuum for a period of 120 days.