991 resultados para Interferon-gamma


Relevância:

60.00% 60.00%

Publicador:

Resumo:

It has been shown that HLA class I molecules play a significant role in the regulation of the proliferation of T cells activated by mitogens and antigens. We evaluated the ability of mAb to a framework determinant of HLA class I molecules to regulate T cell proliferation and interferon gamma (IFN-g) production against leishmania, PPD, C. albicans and tetanus toxoid antigens in patients with tegumentary leishmaniasis and healthy subjects. The anti-major histocompatibility complex (MHC) mAb (W6/32) suppressed lymphocyte proliferation by 90% in cultures stimulated with aCD3, but the suppression was variable in cultures stimulated with leishmania antigen. This suppression ranged from 30-67% and was observed only in 5 of 11 patients. IFN-g production against leishmania antigen was also suppressed by anti-HLA class I mAb. In 3 patients IFN-g levels were suppressed by more than 60%, while in the other 2 cultures IFN-g levels were 36 and 10% lower than controls. The suppression by HLA class I mAb to the proliferative response in leishmaniasis patients and in healthy controls varied with the antigens and the patients or donors tested. To determine whether the suppression is directed at antigen presenting cells (APCs) or at the responding T cells, experiments with antigen-primed non-adherent cells, separately incubated with W6/32, were performed. Suppression of proliferation was only observed when the W6/32 mAb was added in the presence of T cells. These data provide evidence that a mAb directed at HLA class I framework determinants can suppress proliferation and cytokine secretion in response to several antigens.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Although the role of interleukin-2 (IL-2) and interferon gamma (gIFN) is still poorly understood in hyperthyroid diseases, it is reasonable to assume that these cytokines may be present at higher levels in Graves' disease (GD) than in other primarily non-autoimmune thyroid diseases. In order to look for an easy method to distinguish GD from primarily non-autoimmune causes of hyperthyroidism, we compared 13 healthy individuals with 21 treated and untreated hyperthyroid GD patients and with 19 patients with hyperthyroidism due to other etiologies: 7 cases of multinodular goiter, 5 cases of excessive hormone replacement and 7 cases of amiodarone-associated hyperthyroidism. All patients presented low TSH levels and a dubious clinical thyroid state. We found a good correlation between TSH and serum IL-2 levels (r = 0.56; P<0.01). Serum IL-2 (P<0.01) and gIFN (P<0.01) levels were lower in the hyperthyroid group of patients than in control subjects, suggesting a depressed TH1 pattern in the T-cell subset of hyperthyroid patients. GD had normal IL-2 levels, while patients with other forms of thyrotoxicosis presented decreased IL-2 levels (P<0.05). There was no difference between treated and untreated GD patients. We suggest that the direct measurement of serum IL-2 level may help to confirm hyperthyroidism caused by GD.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The gut mucosa is a major site of contact with antigens from food and microbiota. Usually, these daily contacts with natural antigens do not result in inflammatory reactions; instead they result in a state of systemic hyporesponsiveness named oral tolerance. Inflammatory bowel diseases (IBD) are associated with the breakdown of the immunoregulatory mechanisms that maintain oral tolerance. Several animal models of IBD/colitis are available. In mice, these include targeted disruptions of the genes encoding cytokines, T cell subsets or signaling proteins. Colitis can also be induced by intrarectal administration of chemical substances such as 2,4,6-trinitrobenzene sulfonic acid in 50% ethanol. We report here a novel model of colitis induced by intrarectal administration of 50% ethanol alone. Ethanol-treated mice develop an inflammatory reaction in the colon characterized by an intense inflammatory infiltrate in the mucosa and submucosa of the large intestine. They also present up-regulation of both interferon gamma (IFN-gamma) and interleukin-4 (IL-4) production by cecal lymph node and splenic cells. These results suggest a mixed type of inflammation as the substrate of the colitis. Interestingly, cells from mesenteric lymph nodes of ethanol-treated mice present an increase in IFN-gamma production and a decrease in IL-4 production indicating that the cytokine balance is altered throughout the gut mucosa. Moreover, induction of oral tolerance to ovalbumin is abolished in these animals, strongly suggesting that ethanol-induced colitis interferes with immunoregulatory mechanisms in the intestinal mucosa. This novel model of colitis resembles human IBD. It is easy to reproduce and may help us to understand the mechanisms involved in IBD pathogenesis.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Induced oral tolerance to mucosal-exposed antigens in immunized animals is of particular interest for the development of immunotherapeutic approaches to human allergic diseases. This is a unique feature of mucosal surfaces which represent the main contact interface with the external environment. However, the influence of oral tolerance on specific and natural polyreactive IgA antibodies, the major defense mechanism of the mucosa, is unknown. We have shown that oral administration of an extract of the dust mite Dermatophagoides pteronyssinus (Dp) to primed mice caused down-regulation of IgE responses and an increase in tumor growth factor-ß secretion. In the present study, we observed that primed inbred female A/Sn mice (8 to 10 weeks old) fed by gavage a total weight of 1.0-mg Dp extract on the 6th, 7th and 8th days post-immunization presented normal secretion of IL-4 and IL-10 in gut-associated lymphoid tissue and a decreased production of interferon gamma induced by Dp in the draining lymph nodes (13,340 ± 3,519 vs 29,280 ± 2,971 pg/ml). Mice fed the Dp extract also showed higher levels of serum anti-Dp IgA antibodies and an increase of IgA-secreting cells in mesenteric lymph nodes (N = 10), reflecting an increase in total fecal IgA antibodies (N = 10). The levels of secretory anti-Dp IgA antibodies increased after re-immunization regardless of Dp extract feeding. Oral tolerance did not interfere with serum or secretory IgA antibody reactivity related to self and non-self antigens. These results suggest that induction of oral tolerance to a Dp extract in sensitized mice triggered different regulatory mechanisms which inhibited the IgE response and stimulated systemic and secretory IgA responses, preserving the natural polyreactive IgA antibody production.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Several primary immunodeficiency diseases affecting the interleukin 12/interferon gamma (IFN-gamma) pathway have been identified, most of them characterized by recurrent and protracted infections produced by intracellular microorganisms, particularly by several species of mycobacteria. In the present study we analyzed the expression of IFN-gamma receptor (IFN-gammaR) and signal transducer and activator of transcription 1 (STAT-1) in 4 children with Mycobacterium tuberculosis infection of uncommon clinical presentation. These molecules were evaluated by flow cytometry and Western blotting in B cells transformed with Epstein-Barr virus and mutations were scanned by single-strand conformational polymorphisms and DNA sequencing. The expression of IFN-gammaR1 was normal in all 4 patients. The genetic analysis of IFN-gammaR1 and IFN-gammaR2 coding sequences did not reveal any mutation. The expression of the STAT-1 molecule was similar in patients and healthy controls; however, when the phosphorylation of this transcription factor in response to IFN-gamma activation was evaluated by Western blot, a significant lower signal was evident in one patient. These data indicate that there are no alterations in the expression or function of the IFN-gammaR chains in these patients. However, the low level of STAT-1 phosphorylation found in one of these patients might be explained by a defect in one of the molecules involved in the signal transduction pathway after IFN-gamma interacts with its receptor. In the other three patients the inability to eliminate the mycobacteria may be due to a defect in another effector mechanism of the mononuclear phagocytes.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Wheezing associated with respiratory viral infections in infancy is very common and results in high morbidity worldwide. The Th1/Th2 pattern of immune response in these patients remains unclear and previous studies have shown controversial results. The aim of the present study was to compare the type of Th1/Th2 cytokine response between infants with acute bronchiolitis, recurrent wheezing and upper respiratory infections from a developing country. Infants younger than 2 years of age admitted to Hospital São Lucas, Porto Alegre, RS, Brazil, between May and November 2001, with an acute episode of wheezing associated with viral respiratory infection were selected. Subjects with upper respiratory infections from the emergency department were selected for the control group. Interferon-gamma (IFN-gamma) and interleukin-4 (IL-4) levels from nasal aspirates were determined by ELISA from peripheral mononuclear cell cultures. Twenty-nine subjects with acute bronchiolitis, 18 with recurrent wheezing and 15 with upper respiratory infections were enrolled. There were no differences in family history of atopy or parental smoking between groups. Oxygen requirement was similar for the acute bronchiolitis and recurrent wheezing groups. The percentage of positive tests for the cytokines studied and the IFN-gamma/IL-4 ratio was similar for all groups. Comparison of the polarized Th1/Th2 cytokine results for the various groups showed no specific pattern of cytokine production. Infants with wheezing from a developing country do not show any specific predominant pattern of Th1/Th2 cytokine production, suggesting that multiple factors may be involved in the pathogenesis of this illness.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Susceptibility to experimental autoimmune uveitis (EAU) in inbred mice has been associated with a dominant Th1 response. Elevated anti-inter-photoreceptor retinoid-binding protein (anti-IRBP) IgG2a/IgG1 antibody ratios have been implicated as candidate markers to predict disease severity. In the present study, both the anti-IRBP antibody isotype and severity of EAU phenotypes were examined in 4 non-isogenic genetically selected mouse lines to determine if they can be used as general markers of disease. Mice between 8 and 12 weeks old selected for high (H III) or low (L III) antibody response and for maximum (AIR MAX) or minimum (AIR MIN) acute inflammatory reaction (AIR) were immunized with IRBP. Each experiment was performed with at least 5 mice per group. EAU was evaluated by histopathology 21 days after immunization and the minimal criterion was inflammatory cell infiltration of the ciliary body, choroid and retina. Serum IgG1- and IgG2a-specific antibodies were determined by ELISA. EAU was graded by histological examination of the enucleated eyes. The incidence of EAU was lower in AIR MIN mice whereas in the other strains approximately 40% of the animals developed the disease. Low responder animals did not produce anti-IRBP IgG2a antibodies or interferon-gamma. No correlation was observed between susceptibility to EAU and anti-IRBP isotype profiles. Susceptibility to EAU is related to the intrinsic capacity to mount higher inflammatory reactions and increased production of anti-IRBP IgG2a isotype is not necessarily a marker of this immunologic profile.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Our objective was to determine lipid peroxidation and nuclear factor-κB (NF-κB) activation in skeletal muscle and the plasma cytokine profile following maximum progressive swimming. Adult male Swiss mice (N = 15) adapted to the aquatic environment were randomly divided into three groups: immediately after exercise (EX1), 3 h after exercise (EX2) and control. Animals from the exercising groups swam until exhaustion, with an initial workload of 2% of body mass attached to the tail. Control mice did not perform any exercise but were kept immersed in water for 20 min. Maximum swimming led to reactive oxygen species (ROS) generation in skeletal muscle, as indicated by increased thiobarbituric acid reactive species (TBARS) levels (4062.67 ±1487.10 vs 19,072.48 ± 8738.16 nmol malondialdehyde (MDA)/mg protein, control vs EX1). Exercise also promoted NF-κB activation in soleus muscle. Cytokine secretion following exercise was marked by increased plasma interleukin-6 (IL-6) levels 3 h post-exercise (P < 0.05). Interleukin-10 (IL-10) levels were reduced following exercise and remained reduced 3 h post-exercise (P < 0.05). Plasma levels of other cytokines investigated, monocyte chemotactic protein-1 (MCP-1), tumor necrosis factor-alpha (TNF-α), interferon-gamma (IFN-γ) and interleukin-12 (IL-12), were not altered by exercise. The present findings showed that maximum swimming, as well as other exercise models, led to lipid peroxidation and NF-κB activation in skeletal muscle and increased plasma IL-6 levels. The plasma cytokine response was also marked by reduced IL-10 levels. These results were attributed to exercise type and intensity.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Vitamin D metabolites are important in the regulation of bone and calcium homeostasis, but also have a more ubiquitous role in the regulation of cell differentiation and immune function. Severely low circulating 25-dihydroxyvitamin D [25(OH)D] concentrations have been associated with the onset of active tuberculosis (TB) in immigrant populations, although the association with latent TB infection (LTBI) has not received much attention. A previous study identified the prevalence of LTBI among a sample of Mexican migrant workers enrolled in Canada's Seasonal Agricultural Workers Program (SA WP) in the Niagara Region of Ontario. The aim of the present study was to determine the vitamin D status of the same sample, and identify if a relationship existed with LTBI. Studies of vitamin D deficiency and active TB are most commonly carried out among immigrant populations to non-endemic regions, in which reactivation of LTBI has occurred. Currently, there is limited knowledge of the association between vitamin D deficiency and LTBI. Entry into Canada ensured that these individuals did not have active TB, and L TBI status was established previously by an interferon-gamma release assay (IGRA) (QuantiFERON-TB Gold In-Tube®, Cellestis Ltd., Australia). Awareness of vitamin D status may enable individuals at risk of deficiency to improve their nutritional health, and those with LTBI to be aware of this risk factor for disease. Prevalence of vitamin D insufficiency among the Mexican migrant workers was determined from serum samples collected in the summer of 2007 as part of the cross sectional LTBI study. Samples were measured for concentrations of the main circulating vitamin D metabolite, 25(OH)D, with a widely used 1251 250HD RIA (DiaSorin Inc.®, Stillwater, MN), and were categorized as deficient «37.5 nmoI/L), insufficient (>37.5 nmollL, < 80 nmol/L) or sufficient (2::80 nmoI/L). Fisher's exact tests and t tests were used to determine if vitamin D status (sufficiency or insufficiency) or 25(OH)D concentrations significantly differed by sex or age categories. Predictors of vitamin D insufficiency and 25(OH)D concentrations were taken from questionnaires carried out during the previous study, and analyzed in the present study using multiple regression prediction models. Fisher's exact test and t test was used to determine if vitamin D status or 25(OH)D concentration differed by LTBI status. Strength of the relationship between interferongamma (IFN-y) concentration (released by peripheral T cells in response to TB antigens) and 25(OH)D concentration was analyzed using a Spearman correlation. Out of 87 participants included in the study (78% male; mean age 38 years), 14 were identified as LTBI positive but none had any signs or symptoms of TB reactivation. Only 30% of the participants were vitamin D sufficient, whereas 68% were insufficient and 2% were deficient. Significant independent predictors of lower 25(OH)D concentrations were sex, number of years enrolled in the SA WP and length of stay in Canada. No significant differences were found between 25(OH)D concentrations and LTBI status. There was a significant moderate correlation between IFN-y and 25(OH)D concentrations ofLTBI-positive individuals. The majority of participants presented with Vitamin D insufficiency but none were severely deficient, indicating that 25(OH)D concentrations do not decrease dramatically in populations who temporarily reside in Canada but go back to their countries of origin during the Canadian winter. This study did not find a statistical relationship between low levels of vitamin D and LTBI which suggests that in the presence of overall good health, lower than ideal levels of 2S(OH)D, may still be exerting a protective immunological effect against LTBI reactivation. The challenge remains to determine a critical 2S(OH)D concentration at which reactivation is more likely to occur.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Le système immunitaire se doit d’être étroitement régulé afin d’éviter que des réponses immunologiques inappropriées ou de trop forte intensité ne surviennent. Ainsi, différents mécanismes permettent de maintenir une tolérance périphérique, mais aussi d’atténuer la réponse lorsque celle-ci n’est plus nécessaire. De tels mécanismes sont cependant aussi exploités par les tumeurs, qui peuvent ainsi échapper à une attaque par le système immunitaire et donc poursuivre leur progression. Ces mécanismes immunosuppresseurs nuisent non seulement à la réponse naturelle contre les cellules tumorales, mais font aussi obstacle aux tentatives de manipulation clinique de l’immunité visant à générer une réponse anti-tumorale par l’immunothérapie. L’un des mécanismes par lesquels les tumeurs s’évadent du système immunitaire est l’expression d’enzymes responsables du métabolisme des acides aminés dont l’une des principales est l’indoleamine 2,3-dioxygénase (IDO). Cette dernière dégrade le tryptophane et diminue ainsi sa disponibilité dans le microenvironnement tumoral, ce qui engendre des effets négatifs sur la prolifération, les fonctions et la survie des lymphocytes T qui y sont présents. Bien que la régulation de l’expression de cette enzyme ait été largement étudiée chez certaines cellules présentatrices d’antigènes, dont les macrophages et les cellules dendritiques, peu est encore connu sur sa régulation dans les cellules tumorales humaines. Nous avons posé l’hypothèse que différents facteurs produits par les cellules immunitaires infiltrant les tumeurs (TIIC) régulent l’expression de l’IDO dans les cellules tumorales. Nous avons effectivement démontré qu’une expression de l’IDO est induite chez les cellules tumorales humaines, suite à une interaction avec des TIIC. Cette induction indépendante du contact cellulaire résulte principalement de l’interféron-gamma (IFN-g) produit par les lymphocytes T activés, mais est régulée à la baisse par l’interleukine (IL)-13. De plus, la fludarabine utilisée comme agent chimiothérapeutique inhibe l’induction de l’IDO chez les cellules tumorales en réponse aux lymphocytes T activés. Cette observation pourrait avoir des conséquences importantes en clinique sachant qu’une forte proportion d’échantillons cliniques provenant de tumeurs humaines exprime l’IDO. Enfin, les lymphocytes B, qui sont retrouvés également dans certaines tumeurs et qui interagissent étroitement avec les lymphocytes T, sont aussi susceptibles à une induction transcriptionnelle et traductionnelle de l’IDO. Cette enzyme est cependant produite sous une forme inactive dans les lymphocytes B, ce qui rend peu probable l’utilisation de l’IDO par les lymphocytes B comme mécanisme pour freiner la réponse immunitaire. Nos travaux apportent des informations importantes quant à la régulation de l’expression de la molécule immunosuppressive IDO dans les cellules cancéreuses. Ils démontrent que l’expression de l’IDO est influencée par la nature des cytokines présentes dans le microenvironnement tumoral. De plus son expression est inhibée par la fludarabine, un agent utilisé pour le traitement de certains cancers. Ces données devraient être prises en considération dans la planification de futurs essais immunothérapeutiques, et pourraient avoir un impact sur les réponses cliniques anti-tumorales.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Une petite population de lymphocytes T exprimant les deux corécepteurs CD4 et CD8 et appelée double positive (DP), a été détectée dans le sang périphérique de donneurs sains et de patients atteints de diverses pathologies dont la sclérose en plaques (SEP). Nous avons émis l’hypothèse qu’il s’agissait de lymphocytes T hautement activés pouvant contribuer à l’inflammation chronique présente dans la SEP. Nous avons comparé les cellules T DP obtenues du sang de donneurs sains et de patients atteints de la SEP et non traités. La fréquence des cellules DP était similaire chez les patients et les donneurs sains. La proportion de lymphocytes T DP qui exprimaient les chaines du récepteur de l’interleukine-15 (IL-15) était plus élevée que pour les autres populations lymphocytaires. Des mesures d’induction de la phosphorylation du STAT5 (signal transducer and activator of transcription) ont démontré que les cellules DP ont répondu à des doses plus faibles et pour de plus longues périodes à l’IL-15 comparativement aux autres lymphocytes T. Le pourcentage de lymphocytes T DP ayant la capacité de produire l’interféron-gamma et des enzymes lytiques était élevé chez les témoins sains mais ces niveaux étaient significativement réduits chez les patients atteints de la SEP. La caractérisation phénotypique de cellules DP a suggéré que ces cellules ont des propriétés similaires aux lymphocytes T activés. Bien qu’il ne s’agisse que d’une caractérisation partielle, il semble que les lymphocytes T DP perdent une partie de leurs propriétés chez les patients atteints de la SEP.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Dentro del marco del aborto involuntario recurrente (AIR), se han propuesto causas autoinmunes y alogénicas, e implementación de terapias como la inmunización activa con leucocitos alogénicos de la pareja o de donantes. La evidencia disponible en cuanto a la efectividad de estos tratamientos es contradictoria, por lo que se desea realizar una revisión sistemática para evaluar la efectividad de la inmunización activa con leucocitos alogénicos de la pareja o de donantes para esta condición. Se realizó un estudio tipo revisión sistemática de la literatura, usando las siguientes bases de datos: Medline, Embase, Cochrane Library y Scielo. Se realizó una búsqueda a través del registro de ensayos clínicos del Instituto Nacional de Salud de los Estados Unidos (www.clinicaltrials.gov) y, una búsqueda manual a través de las referencias de los estudios seleccionados siguiendo la estrategia de bola de nieve. Se seleccionaron ensayos clínicos y estudios de cohorte analítica, en idioma inglés y español. Se realizó un análisis cuantitativo de la información por medio de un metaanálisis. El tratamiento inmunomodulador con linfocitos puede considerarse como una terapia efectiva para mantener la gestación y lograr recién nacido vivo según resultados estadísticos; sin embargo la calidad de los estudios incluidos es baja, por lo que no se aconseja para la práctica rutinaria. Se sugiere la realización de estudios con metodologías robustas y que apoyen los resultados presentados en esta investigación.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

There has been much recent interest in the cardiovascular benefits of dietary isoflavones. The aim of the present in vitro studies was to investigate potential anti-thrombogenic and anti-atherogenic effects of the isoflavones genistein and daidzein in platelets, macrophages and endothelial cells. Pre-treatment with either isoflavone inhibited collagen-induced platelet aggregation in a dose-dependent manner. In a macrophage cell line (RAW 264-7) activated with interferon gamma plus lipopolysaccharide, both isoflavones were found to inhibit NO production and tumour necrosis factor alpha (TNF-alpha) secretion dose-dependently, but they did not affect mRNA levels for inducible nitric oxide synthase and cyclo-oxygenase-2. Both isoflavones also dose-dependently decreased monocyte chemoattractant protein-1 secretion induced by TNF-alpha in human umbilical vein endothelial cells. Compared with daidzein, genistein exerted greater inhibitory effects for all parameters studied. The present data contributes to our knowledge on the molecular mechanisms by which isoflavones may protect against coronary artery disease. Further studies are required to determine whether the effects of isoflavones observed in the current in vitro studies are relevant to the aetiology of coronary artery disease in vivo.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

TGF-beta1 levels increase after vascular injury and promote vascular smooth muscle cell (VSMC) proliferation. We define a nonviral gene delivery system that targets alphavbeta3 and alpha5beta1 integrins that are expressed on proliferating VSMCs and strongly induced by TGF-beta1. A 15-amino acid RGDNP-containing peptide from American Pit Viper venom was linked to a Lys(16) peptide as vector (molossin vector) and complexed with Lipofectamine or fusogenic peptide for delivery of luciferase or beta-galactosidase reporter genes to primary cultures of human, rabbit, and rat VSMCs. Preincubation of VSMCs with TGF-beta1 for 24 h, but not with PDGF-BB, interferon-gamma, TNF-alpha, nor PMA, increased alphavbeta3 and alpha5beta1 expressions on VSMCs and enhanced gene delivery of molossin vector. Thus beta-galactosidase activity increased from 35 +/- 5% (controls) to 75 +/- 5% after TGF-beta1 treatment, and luciferase activity increased fourfold over control values. Potential use of this system in vessel bypass surgery was examined in an ex vivo rat aortic organ culture model after endothelial damage. Molossin vector system delivered beta-galactosidase to VSMCs in the vessel wall that remained for up to 12 days posttransfection. The molossin vector system, when combined with TGF-beta1, enhances gene delivery to proliferating VSMCs and might have clinical applications for certain vasculoproliferative diseases.