Identification of Salmonella spp. isolates from chicken abattoirs by multiplex-PCR

The present study was carried out to report the occurrence Salmonella spp., Salmonella Enteritidis, and Salmonella Typhimurium in chicken abattoirs. Samples of feces; feathers; scald, evisceration, and chiller water; and rinse water of non-eviscerated, eviscerated, and chilled carcass were collected from six chicken abattoirs. Salmonella isolates were identified by a multiplex-PCR using three sets of primers targeting the inuA, pefA, and sefA gene sequences from Salmonella spp., S. Typhimurium and S. Enteritidis, respectively. Salmonella spp. was detected in 10% (29/288) of the samples, whereas serovars Enteritidis and Typhimurium were identified in 62% (7/288), respectively. The results indicate the need to improve hygiene and sanitary standards in poultry slaughter lines, besides the education of food handlers and information to consumers. (c) 2006 Elsevier Ltd. All rights reserved.

Comparative validation using quantitative real-time PCR (qPCR) and conventional PCR of bovine semen centrifuged in continuous density gradient

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Sexagem de embriões bovinos fecundados in vitro pela técnica de PCR multiplex

Neste trabalho, a técnica de PCR (polymerase chain reaction) foi utilizada para a sexagem de 92 embriões bovinos fertilizados in vitro. Os embriões originaram-se de fertilização in vitro de oócitos aspirados de ovários de fêmeas bovinas, provenientes de abatedouros comerciais. Os oócitos foram maturados, fertilizados e cultivados até o estádio de blastocisto. Os embriões foram lavados em solução de PBS, transferidos para tubos de polipropileno contendo água ultrapura, e imediatamente congelados a -196ºC. Os embriões foram descongelados sobre isopor contendo gelo picado e tratados com proteinase K. Para a reação de PCR, utilizaram-se alíquotas de 34 µl de cada tudo, onde foram acrescidos dois pares de primers, seqüência BC1.2 e seqüência satélite 1.715, desoxinucleotídeos, MgCl2, tampão PCR 10X, TaqDNA polimerase e água, em um volume final de 50 µl. As amostras foram amplificadas e a eletroforese realizada em gel de poliacrilamida a 8%. Os géis foram corados com solução de brometo de etídio e analisados em transiluminador de luz ultravioleta. Um índice de 93,47% de amplificação foi atingido, com 41 embriões (47,67%) machos e 45 (52,32%) embriões fêmeas. O uso de gel de poliacrilamida a 8% foi eficaz na separação de fragmentos de DNA muito próximos.

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

In vitro culture, PCR , and nested PCR for the detection of Theileria equi in horses submitted to exercise

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Detection of bovine herpesvirus 5 (BoHV-5) in formalin-fixed, paraffin-embedded bovine brain by nested PCR in Colombian cattle

Fifteen cases of viral meningoencephalitis in Colombian cattle were tested by nested PCR analysis for the detection of bovine herpesvirus 5 (BoHV-5). All fatal cases had shown severe neurological signs and had occurred following natural outbreaks of the disease. The neurological infection was histologically characterized by mild to moderate inflammatory changes in the brain and cerebellum, including meningitis, mononuclear perivascular cuffing, gliosis, haemorrhage, and the presence of Gitter cells (macrophages) accompanying large areas of malacia. No intranuclear inclusion bodies were seen in any of the cases. Results from BoHV-5 molecular extraction analyses showed there were five positive cases thus confirming the presence of the virus in Colombia.

Sensitivity evaluation of a single-step PCR assay using Ehrlichia canis p28 gene as a target and its application in diagnosis of canine ehrlichiosis

O objetivo deste estudo foi aperfeiçoar um ensaio de PCR que amplificasse um fragmento de 843 pares de bases do gene p28 da Ehrlichia canis e compará-lo com outros dois métodos de PCR utilizados para amplificar partes do gene 16S rRNA e dsb do gênero Ehrlichia. Amostras sanguíneas foram colhidas de cães com diagnóstico clínico de erliquiose. A amplificação do gene p28 pela PCR produziu um fragmento de 843pb e esse ensaio permitiu a detecção do DNA de um parasita dentre 1 bilhão de células. Todas as amostras positivas detectadas pela PCR baseada no gene p28 foram também positivas pela nested PCR para detecção do gene 16S rRNA e também pela PCR dsb. Dentre as amostras negativas para a PCR p28, 55,3% foram co-negativas, mas 27,6% foram positivas pela PCR baseada nos genes 16S rRNA e dsb. A PCR p28 parece ser um teste útil para detecção molecular de E. canis, entretanto otimizações na sensibilidade nesta PCR são necessárias, para que esta técnica se torne uma importante alternativa no diagnóstico da erliquiose canina.

A nested-PCR assay for detection of Xylella fastidiosa in citrus plants and sharpshooter leafhoppers

Aims: Detection of Xylella fastidiosa in citrus plants and insect vectors.Methods and Results: Chelex 100 resin matrix was successfully standardized allowing a fast DNA extraction of X. fastidiosa. An amplicon of 500 bp was observed in samples of citrus leaf and citrus xylem extract, with and without symptoms of citrus variegated chlorosis, using PCR with a specific primer set indicating the presence of X. fastidiosa. The addition of insoluble acid-washed polyvinylpyrrolidone (PVPP) prior to DNA extraction of insect samples using Chelex 100 resin together with nested-PCR permitted the detection of X. fastidiosa within sharpshooter heads with great sensitivity. It was possible to detect up to two bacteria per reaction. From 250 sharpshooter samples comprising four species (Dilobopterus costalimai, Oncometopia facialis, Bucephalogonia xanthopis and Acrogonia sp.), 87 individuals showed positive results for X. fastidiosa in a nested-PCR assay.Conclusions: the use of Chelex 100 resin allowed a fast and efficient DNA extraction to be used in the detection of X. fastidiosa in citrus plants and insect vectors by PCR and nested-PCR assays, respectively.Significance and Impact of the study: the employment of efficient and sensitive methods to detect X. fastidiosa in citrus plants and insect vectors will greatly assist epidemiological studies.

Selection and validation of reference genes for gene expression studies by reverse transcription quantitative PCR in Xanthomonas citri subsp citri during infection of Citrus sinensis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Um sistema computacional para diagnosticar viroses de plantas usando a técnica de PCR com construção de primers espécie-específicos

It proposes a established computational solution in the development of a software to construct species-specific primers, used to improve the diagnosis of virus of plant for PCR. Primers are indispensable to PCR reaction, besides providing the specificity of the diagnosis. Primer is a synthetic, short, single stranded piece of DNA, used as a starter in PCR technique. It flanks the sequence desired to amplify. Species-specific primers indicate the well known region of beginning and ending where the polymerase enzyme is going to amplify on a certain species, i.e. it is specific for only a species. Thus, the main objective of this work is to automatize the process of choice of primers, optimizing the specificity of chosen primers by the traditional method

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Strains of Xylella fastidiosa rapidly distinguished by arbitrarily primed-PCR

Genomic DNAs isolated from strains of Xylella fastidiosa that caused citrus variegated chlorosis, coffee leaf scorch, Pierce's Disease of grapevine, and plum leaf scorch were analyzed by arbitrarily primed polymerase chain reaction. Purified DNA was amplified under nonstringent conditions with single primers 21 nucleotides (nt) long. Thirty-nine amplification products were observed that were useful to distinguish among the strains and to derive a similarity matrix and construct a phenogram showing possible relationships among the strains. Strains isolated from diseased coffee and citrus in Brazil were closely related to each other (coefficient of similarity of 0.872), but only distantly related to a strain isolated from diseased grapevine in the USA (coefficient of similarity of 0.650). Strains of Xylella fastidiosa isolated from diseased plums in the USA and Brazil clustered with strains from different hosts isolated from their respective countries of origin. Thus, there may be two quite dissimilar clusters of strains of Xylella fastidiosa, one in North America and the other in South America. Each cluster contains strains that can cause disease in plum. The methods described provide a convenient and rapid method to distinguish between strains of Xylella fastidiosa that cause diseases of coffee and citrus in the same region of Brazil. This has not been possible previously. This will potentially enable the two strains to be distinguished in alternate hosts or in insect vectors.