976 resultados para Human immune systems


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Tumor antigen-specific CD4(+) T cells generally orchestrate and regulate immune cells to provide immune surveillance against malignancy. However, activation of antigen-specific CD4(+) T cells is restricted at local tumor sites where antigen-presenting cells (APCs) are frequently dysfunctional, which can cause rapid exhaustion of anti-tumor immune responses. Herein, we characterize anti-tumor effects of a unique human CD4(+) helper T-cell subset that directly recognizes the cytoplasmic tumor antigen, NY-ESO-1, presented by MHC class II on cancer cells. Upon direct recognition of cancer cells, tumor-recognizing CD4(+) T cells (TR-CD4) potently induced IFN-γ-dependent growth arrest in cancer cells. In addition, direct recognition of cancer cells triggers TR-CD4 to provide help to NY-ESO-1-specific CD8(+) T cells by enhancing cytotoxic activity, and improving viability and proliferation in the absence of APCs. Notably, the TR-CD4 either alone or in collaboration with CD8(+) T cells significantly inhibited tumor growth in vivo in a xenograft model. Finally, retroviral gene-engineering with T cell receptor (TCR) derived from TR-CD4 produced large numbers of functional TR-CD4. These observations provide mechanistic insights into the role of TR-CD4 in tumor immunity, and suggest that approaches to utilize TR-CD4 will augment anti-tumor immune responses for durable therapeutic efficacy in cancer patients.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The main goal of the InterAmbAr reseach project is to analyze the relationships between landscape systems and human land-use strategies on mountains and littoral plains from a long-term perspective. The study adopts a high resolution analysis of small-scale study areas located in the Mediterranean region of north-eastern Catalonia. The study areas are distributed along an altitudinal transect from the high mountain (above 2000m a.s.l.) to the littoral plain of Empordà (Fig. 1). High resolution interdisciplinary research has been carried out from 2010, based on the integration of palaeoenvironmental and archaeological data. The micro-scale approach is used to understand human-environmental relationships. It allows better understanding of the local-regional nature of environmental changes and the synergies between catchment-based systems, hydro-sedimentary regimes, human mobility, land-uses, human environments, demography, etc.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Nitric oxide (NO) is an extremely important and versatile messenger in biological systems. It has been identified as a cytotoxic factor in the immune system, presenting anti- or pro-inflammatory properties under different circumstances. In murine monocytes and macrophages, stimuli by cytokines or lipopolysaccharide (LPS) are necessary for inducing the immunologic isoform of the enzyme responsible for the high-output production of NO, nitric oxide synthase (iNOS). With respect to human cells, however, LPS seems not to stimulate NO production in the same way. Addressing this issue, we demonstrate here that peripheral blood mononuclear cells (PBMC) obtained from schistosomiasis-infected patients and cultivated with parasite antigens in the in vitro granuloma (IVG) reaction produced more nitrite in the absence of LPS. Thus, LPS-induced nitrite levels are easily detectable, although lower than those detected only with antigenic stimulation. Concomitant addition of LPS and L-N-arginine methyl ester (L-NAME) restored the ability to produce detectable levels of nitrite, which had been lost with L-NAME treatment. In addition, LPS caused a mild decrease of the IVG reaction and its association with L-NAME was responsible for reversal of the L-NAME-exacerbating effect on the IVG reaction. These results show that LPS alone is not as good an NO inducer in human cells as it is in rodent cells or cell lines. Moreover, they provide evidence for interactions between LPS and NO inhibitors that require further investigation.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

La méthylation de l'ADN est une marque épigénétique importante chez les mammifères. Malgré le fait que la méthylation de la cytosine en 5' (5mC) soit reconnue comme une modification épigénétique stable, il devient de plus en plus reconnu qu'elle soit un processus plus dynamique impliquant des voies de méthylation et de déméthylation actives. La dynamique de la méthylation de l'ADN est désormais bien caractérisée dans le développement et dans le fonctionnement cellulaire des mammifères. Très peu est cependant connu concernant les implications régulatrices dans les réponses immunitaires. Pour se faire, nous avons effectué des analyses du niveau de transcription des gènes ainsi que du profilage épigénétique de cellules dendritiques (DCs) humaines. Ceux-ci ont été faits avant et après infection par le pathogène Mycobacterium tuberculosis (MTB). Nos résultats fournissent le premier portrait génomique du remodelage épigénétique survenant dans les DCs en réponse à une infection bactérienne. Nous avons constaté que les changements dans la méthylation de l'ADN sont omniprésents, identifiant 3,926 régions différentiellement méthylées lors des infections par MTB (MTB-RDMs). Les MTB-RDMs montrent un chevauchement frappant avec les régions génomiques marquées par les histones associées avec des régions amplificatrices. De plus, nos analyses ont révélées que les MTB-RDMs sont activement liées par des facteurs de transcription associés à l'immunité avant même d'être infecté par MTB, suggérant ces domaines comme étant des éléments d'activation dans un état de dormance. Nos données suggèrent que les changements actifs dans la méthylation jouent un rôle essentiel pour contrôler la réponse cellulaire des DCs à l'infection bactérienne.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

This document is aimed first of all, make a small introductory reference on the three levels of protection of fundamental rights in Europe with the idea of helping to clarify and understand mainly to non-European systems that we are not talking. For that, based on this, going on to assess the impact generated in these systems suggest that the complaints alleged involvement of European countries in secret CIA flights to combat international terrorism, as well as investigate the responses that have given each protection of these areas to try to clarify them. 

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The history of using vesicular systems for drug delivery to and through skin started nearly three decades ago with a study utilizing phospholipid liposomes to improve skin deposition and reduce systemic effects of triamcinolone acetonide. Subsequently, many researchers evaluated liposomes with respect to skin delivery, with the majority of them recording localized effects and relatively few studies showing transdermal delivery effects. Shortly after this, Transfersomes were developed with claims about their ability to deliver their payload into and through the skin with efficiencies similar to subcutaneous administration. Since these vesicles are ultradeformable, they were thought to penetrate intact skin deep enough to reach the systemic circulation. Their mechanisms of action remain controversial with diverse processes being reported. Parallel to this development, other classes of vesicles were produced with ethanol being included into the vesicles to provide flexibility (as in ethosomes) and vesicles were constructed from surfactants and cholesterol (as in niosomes). Thee ultradeformable vesicles showed variable efficiency in delivering low molecular weight and macromolecular drugs. This article will critically evaluate vesicular systems for dermal and transdermal delivery of drugs considering both their efficacy and potential mechanisms of action.

Relevância:

40.00% 40.00%

Publicador:

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Recent studies of the current state of rural education and training (RET) systems in sub-Saharan Africa have assessed their ability to provide for the learning needs essential for more knowledgeable and productive small-scale rural households. These are most necessary if the endemic causes of rural poverty (poor nutrition, lack of sustainable livelihoods, etc.) are to be overcome. A brief historical background and analysis of the major current constraints to improvement in the sector are discussed. Paramount among those factors leading to its present 'malaise' is the lack of a whole-systems perspective and the absence of any coherent policy framework in most countries. There is evidence of some recent innovations, both in the public sector and through the work of non-governmental organisations (NGOs), civil society organisations (CSOs) and other private bodies. These provide hope of a new sense of direction that could lead towards meaningful 'revitalisation' of the sector. A suggested framework offers 10 key steps which, it is argued, could largely be achieved with modest internal resources and very little external support, provided that the necessary leadership and managerial capacities are in place. (C) 2006 Elsevier Ltd. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The outer domain (OD) of human immunodeficiency virus (HIV)-1 gp120 represents an attractive, if difficult, target for a beneficial immune response to HIV infection. Unlike the entire gp120, the OD is structurally stable and contains the surfaces that interact with both the primary and secondary cellular receptors. The primary strain-specific neutralizing target, the V3 loop, lies within the OD, as do epitopes for two cross-reactive neutralizing monoclonal antibodies (mAbs), b12 and 2G12, and the contact sites for a number of inhibitory lectins. The OD is poorly immunogenic, at least in the context of complete gp120, but purposeful OD immunization can lead to a substantial antibody response. Here, we map the antibody generated following immunization with a clade C OD. In contrast to published data for the clade B OD, the majority of the polyclonal response to the complete clade C OD is to the V3 loop; deletion of the loop substantially reduces immunogenicity. When the loop sequence was substituted for the epitope for 2F5, a well-characterized human cross-neutralizing mAb, a polyclonal response to the epitope was generated. A panel of mAbs against the clade C OD identified two mAbs that reacted with the loop and were neutralizing for clade C but not B isolates. Other mAbs recognized both linear and conformational epitopes in the OD. We conclude that, as for complete gp120, V3 immunodominance is a property of OD immunogens, that the responses can be neutralizing and that it could be exploited for the presentation of other epitopes.