888 resultados para Human genetics -- Moral and ethical aspects
Resumo:
A. peregrina var. falcata form mutualistic symbiosis with arbuscular mycorrhizal fungus. An anatomical and ultrastructural study was carried out to analyze some aspects of this simbiotic association as well as some root features. The results evidenced the presence of fibers with non-lignified thicked secondary walls in the stele and sparse papillae on root surface. A. peregrina var. falcata mycorrhizas presented features of Arum-type (intercellular hyphae) and Paris-type (extensive coils) arbuscular mycorrhiza. Their general appearance with extraradical hyphae, intracellular coils, intercellular hyphae and arbuscules, is in agreement with arbuscular mycorrhizas of several plants. The ultrastructural observations showed that in intercellular hyphae and arbuscules vacuoles were dominant and that in rough endoplasmatic reticulum and small vesicles seems to be associated with arbuscule senescence process.
Resumo:
The main purpose of the present doctoral thesis is to investigate subjective experiences and cognitive processes in four different types of altered states of consciousness: naturally occurring dreaming, cognitively induced hypnosis, pharmacologically induced sedation, and pathological psychosis. Both empirical and theoretical research is carried out, resulting in four empirical and four theoretical studies. The thesis begins with a review of the main concepts used in consciousness research, the most influential philosophical and neurobiological theories of subjective experience, the classification of altered states of consciousness, and the main empirical methods used to study consciousness alterations. Next, findings of the original studies are discussed, as follows. Phenomenal consciousness is found to be dissociable from responsiveness, as subjective experiences do occur in unresponsive states, including anaesthetic-induced sedation and natural sleep, as demonstrated by post-awakening subjective reports. Two new tools for the content analysis of subjective experiences and dreams are presented, focusing on the diversity, complexity and dynamics of phenomenal consciousness. In addition, a new experimental paradigm of serial awakenings from non-rapid eye movement sleep is introduced, which enables more rapid sampling of dream reports than has been available in previous studies. It is also suggested that lucid dreaming can be studied using transcranial brain stimulation techniques and systematic analysis of pre-lucid dreaming. For blind judges, dreams of psychotic patients appear to be indistinguishable from waking mentation reports collected from the same patients, which indicates a close resemblance of these states of mind. However, despite phenomenological similarities, dreaming should not be treated as a uniform research model of psychotic or intact consciousness. Contrary to this, there seems to be a multiplicity of routes of how different states of consciousness can be associated. For instance, seemingly identical time perception distortions in different alterations of consciousness may have diverse underlying causes for these distortions. It is also shown that altered states do not necessarily exhibit impaired cognitive processing compared to a baseline waking state of consciousness: a case study of time perception in a hypnotic virtuoso indicates a more consistent perceptual timing under hypnosis than in a waking state. The thesis ends with a brief discussion of the most promising new perspectives for the study of alterations of consciousness.
Resumo:
Samples of healthy leaves and galls induced by Schizomyia macrocapillata Maia on Bauhinia brevipes Vogel were submitted to routine techniques to investigate gall anatomy and development. Pouch galls are induced on the abaxial surface of unfolded immature leaves, and become spheroid with long reddish hairs covering their external surface. Galls occur isolated or coalesce when in larger numbers. Gall development was divided into six phases: 1) initiation; 2) tissue re-arrangement; 3) tissue differentiation; 4) maturation; 5) growth phase; and 6) dehiscence. This last phase corresponds to gall senescence, which takes place just after the larva exits the chamber to pupate. An important developmental phase of tissue reorientation was recorded after the initiation phase. The presence of hyphae close to the covering layer characterizes this gall as an ambrosia gall and the feeding mode of the gall migde is discussed. Few hyphae were found during the first developmental phases and fungi may play an important role during gall morphogenesis. Neoformed trichomes may provide not only photoprotection but also protection against natural enemies and water loss. The neoformation of phloematic bundles suggests host manipulation and indicates the establishment of a deviating sink.
Resumo:
Background: Multiple Sclerosis (MS) is an autoimmune disease of the central nervous system that affects most commonly young women in their childbearing age. Previous studies have shown that MS relapse rate usually reduces during pregnancy and increases again after delivery. Patients with MS and their treating physicians are interested to know more about the risks the disease can cause to pregnancy and how pregnancy affects the disease. The reasons for increased relapse rate after delivery are not entirely clear, but loss of pregnancy related immune tolerance and changes in the hormonal status at the time of delivery seem to be of relevance. Aims and methods: The aims of this study were to follow the natural course of MS during and after pregnancy, evaluate pregnancy related risks among MS patients, follow the inflammatory response of MS patients during and after pregnancy and clarify the risk of relevant co-morbidities known to affect other autoimmune diseases after pregnancy and compare these results to healthy controls. This study was a part of a prospective nation-wide follow-up study of 60 Finnish MS patients. All eligible MS patients were enrolled in the study during the years 2003-2005. A prospective followup continued from early pregnancy until six months postpartum. MS relapses, EDSS scores and obstetric details were recorded. Blood samples were obtained from the patients at early, middle, and late pregnancy, after delivery and one month, three months and six months postpartum. Results: MS patients were no more likely to experience pregnancy or delivery complications than the Finnish mothers in general. The need of instrumental assistance, however, was higher among mothers with MS. Disease activity followed the course seen in previous studies. The majority of mothers (90.2%) breastfed their babies. Contrary to previous results, breastfeeding did not protect MS patients from disease worsening after delivery in present study. Mothers with active pre-pregnancy disease chose to breastfeed less frequently and started medication instead. MS patients presented with higher prevalence of elevated thyroid autoantibodies postpartum than healthy controls, but the rate of thyroid hormonal dysfunction was similar as that of healthy controls. The mode of delivery nor the higher rate of tissue damage assessed with C-reactive protein concentration were not predictive of postpartum relapses. The prevalence of gestational diabetes was slightly higher among mothers with MS compared to Finnish mothers in general, but postpartum depression was observed in similar rates. MS patients presented with significantly lower serum concentrations of vitamin D during pregnancy and postpartum than healthy controls. Conclusions: Childbearing can be regarded as safe for mothers with MS as it is for healthy mothers in general. Breastfeeding can be recommended, but it should be done only after careful evaluation of the individual risk for postpartum disease activation. Considering MS patients tend to develop thyroid antibody positivity after delivery more often than healthy controls and that certain treatments can predispose MS patients to thyroid hormonal dysfunction, we recommend MS mothers to be screened for thyroid abnormalities during pregnancy and after delivery. Increased risk for gestational diabetes should be kept in mind when following MS mothers and glucose tolerance test in early pregnancy should be considered. Adequate vitamin D supplementation is essential for MS mothers also during pregnancy and postpartum period.
Resumo:
The vasorelaxant effects of SR 47063 (4-(2-cyanimino-1,2-dihydropyrid-1-yl)-2,2-dimethyl-6-nitrochromene), a new K+-channel opener structurally related to levcromakalim, were examined in isolated human saphenous vein (HSV) and rat aorta (RA). HSV or RA rings were precontracted with either KCl or noradrenaline and cumulative relaxant concentration-response curves were obtained for SR 47063 (0.1 nM to 1 µM) in the presence or absence of 3 µM glibenclamide. SR 47063 potently relaxed HSV and RA precontracted with 20 mM (but not 60 mM) KCl or 10 µM noradrenaline in a concentration-dependent manner, showing slightly greater activity in the aorta. The potency of the effect of SR 47063 on HSV and RA was 12- and 58-fold greater, respectively, than that reported for the structurally related K+-channel opener levcromakalim. The vasorelaxant action of SR 47063 in both blood vessels was strongly inhibited by 3 µM glibenclamide, consistent with a mechanism of action involving ATP-dependent K+-channels.
Resumo:
Osteoporosis is a multifactorial disease with great impact on morbidity and mortality mainly in postmenopausal women. Although it is recognized that factors related to life-style and habits may influence bone mass formation leading to greater or lower bone mass, more than 85% of the variation in bone mineral density (BMD) is genetically determined. The collagen type I alpha 1 (COLIA1) gene is a possible risk factor for osteoporosis. We studied a population of 220 young women from the city of São Paulo, Brazil, with respect to BMD and its correlation with both COLIA1 genotype and clinical aspects. The distribution of COLIA1 genotype SS, Ss and ss in the population studied was 73.6, 24.1 and 2.3%, respectively. No association between these genotypes and femoral or lumbar spine BMD was detected. There was a positive association between lumbar spine BMD and weight (P<0.0001), height (P<0.0156), and body mass index (BMI) (P<0.0156), and a negative association with age at menarche (P<0.0026). There was also a positive association between femoral BMD and weight (P<0.0001), height (P<0.0001), and BMI (P<0.0001), and a negative correlation with family history for osteoporosis (P<0.041). There was no association between the presence of allele s and reduced BMD. We conclude that a family history of osteoporosis and age at menarche are factors that may influence bone mass in our population.
Resumo:
In the present paper we discuss the development of "wave-front", an instrument for determining the lower and higher optical aberrations of the human eye. We also discuss the advantages that such instrumentation and techniques might bring to the ophthalmology professional of the 21st century. By shining a small light spot on the retina of subjects and observing the light that is reflected back from within the eye, we are able to quantitatively determine the amount of lower order aberrations (astigmatism, myopia, hyperopia) and higher order aberrations (coma, spherical aberration, etc.). We have measured artificial eyes with calibrated ametropia ranging from +5 to -5 D, with and without 2 D astigmatism with axis at 45º and 90º. We used a device known as the Hartmann-Shack (HS) sensor, originally developed for measuring the optical aberrations of optical instruments and general refracting surfaces in astronomical telescopes. The HS sensor sends information to a computer software for decomposition of wave-front aberrations into a set of Zernike polynomials. These polynomials have special mathematical properties and are more suitable in this case than the traditional Seidel polynomials. We have demonstrated that this technique is more precise than conventional autorefraction, with a root mean square error (RMSE) of less than 0.1 µm for a 4-mm diameter pupil. In terms of dioptric power this represents an RMSE error of less than 0.04 D and 5º for the axis. This precision is sufficient for customized corneal ablations, among other applications.
Resumo:
The paper studied marketing of automatic fire suppression systems from the perspectives of customer value and institutions. The object of the study was research the special features of the sales and marketing of fire suppression systems, and find some practical applications for sales, and for lobbying of a new fire suppression technology. The theoretical background of the study was in the customer value literature and the theoretical concept of institutional entrepreneurship. The research was conducted as an electronic survey for three different groups of respondents; end customers, solution integrators, and re-sellers. From the answers was gathered generalisations about the customer value assessment and communication of the value related to the sales and marketing processes of the fire suppression systems. In addition, there was observed manners to receive information about the systems, and effects caused by institutions to the decision making of the different parties involved. The findings of the study support companies that are launching a new safety technology to the market focus their marketing, and help to understand institutional forces that are affecting to a safety related product.
Resumo:
The etiopathogenesis of vulvar intraepithelial neoplasia (VIN III) and invasive squamous cell carcinoma are largely unknown. Since there are few studies on Brazilian patients, our purpose was to determine the frequency of human papillomavirus (HPV) infection and the expression of p53 in these lesions, and associate them with other factors such as age, morphological subtypes, multicentric and multifocal disease. Thirty-eight cases of VIN III, nine of superficially invasive carcinoma, and 55 of invasive vulvar carcinoma were retrospectively evaluated from 1983 to 1995 for the presence of HPV by immunohistochemistry and in situ hybridization, and for p53 protein expression by immunohistochemistry on paraffin sections. All cases for whom material (slides and paraffin blocks) and clinical data were available were included. HPV and p53 were detected in 57.9 and 21.1% of the VIN III lesions, 33.3 and 66.7% of superficially invasive carcinomas, and 7.3 and 58.2% of invasive squamous cell carcinomas, respectively. HPV infection was associated with younger age in the VIN III and invasive carcinoma groups. In the latter, HPV infection was associated with the basaloid variant. p53 expression rate was higher in superficially invasive and invasive lesions and was not related to HPV infection. Our findings are similar to others and support the hypothesis that there are two separate entities of the disease, one associated with HPV and the other unrelated, with p53 inactivation possibly being implicated in some of the cases.
Resumo:
Children with chronic renal failure in general present growth retardation that is aggravated by corticosteroids. We describe here the effects of methylprednisolone (MP) and recombinant human growth hormone (rhGH) on the growth plate (GP) of uremic rats. Uremia was induced by subtotal nephrectomy in 30-day-old rats, followed by 20 IU kg-1 day-1 rhGH (N = 7) or 3 mg kg-1 day-1 MP (N = 7) or 20 IU kg-1 day-1 rhGH + 3 mg kg-1 day-1 MP (N = 7) treatment for 10 days. Control rats with intact renal function were sham-operated and treated with 3 mg kg-1 day-1 MP (N = 7) or vehicle (N = 7). Uremic rats (N = 7) were used as untreated control animals. Structural alterations in the GP and the expression of anti-proliferating cell nuclear antigen (PCNA) and anti-insulin-like growth factor I (IGF-I) by epiphyseal chondrocytes were evaluated. Uremic MP rats displayed a reduction in the proliferative zone height (59.08 ± 4.54 vs 68.07 ± 7.5 µm, P < 0.05) and modifications in the microarchitecture of the GP. MP and uremia had an additive inhibitory effect on the proliferative activity of GP chondrocytes, lowering the expression of PCNA (19.48 ± 11.13 vs 68.64 ± 7.9% in control, P < 0.0005) and IGF-I (58.53 ± 0.96 vs 84.78 ± 2.93% in control, P < 0.0001), that was counteracted by rhGH. These findings suggest that in uremic rats rhGH therapy improves longitudinal growth by increasing IGF-I synthesis in the GP and by stimulating chondrocyte proliferation.
Resumo:
Women living in Latin American countries bear a disproportionate burden of cervical cancer, a condition caused by infection with the human papillomavirus (HPV). We performed a study in Santa Elena, Guayas (currently Santa Elena Province), Ecuador, to determine how often HPV could be detected in women attending a private cancer screening clinic. Participants underwent a Pap test, and vaginal and cervical swabs were performed for HPV testing by the polymerase chain reaction (PCR). Each participant completed a verbally administered survey. The mean age of 302 participants was 37.7 years (range 18 to 78 years). The majority of cervical and vaginal specimens contained sufficient DNA to perform PCR. Overall, 24.2% of the participants had either a cervical or vaginal swab that tested positive for HPV. In general, there was a good correlation between the HPV types detected in the cervical and vaginal swabs from the participants, but vaginal swabs were more likely to contain HPV DNA than were cervical swabs. The high-risk HPV types 16, 52, 58, and 59 and the low-risk HPV types 62, 71, 72, and 83 were the most frequently detected HPV types. The number of lifetime sexual partners was positively associated with detection of any HPV type, detection of oncogenic HPV, and abnormal Pap smears. Further studies are needed to determine if these results are representative of all Ecuadorian women and to determine if cervical cancers in Ecuadorian women are caused by the same HPV types found in the swab specimens obtained in this study.
Resumo:
Esophageal cancer is a prevalent cancer worldwide. Some studies have reported the possible etiology of human papillomavirus (HPV) in benign and malignant papillomas of the esophagus but the conclusions are controversial. In the present study, we investigated an esophageal papilloma from a 30-year-old male patient presenting aphasia. HPV DNA was detected by generic PCR using MY09/11 primers, and restriction fragment length polymorphism revealed the presence of HPV54, usually associated with benign genital lesions. Hypermethylation of the pINK4A gene was also investigated due to its relation to malignant transformation, but no modification was detected in the host gene. Except for an incipient reflux, no risk factors such as cigarette smoking, alcohol abuse or an infected sexual partner were recorded. Since esophageal lesions may have a malignant potential, HPV detection and typing are useful tools for patient follow-up.
Resumo:
Preimplantation genetic diagnosis (PGD) was originally developed to diagnose embryo-related genetic abnormalities for couples who present a high risk of a specific inherited disorder. Because this technology involves embryo selection, the medical, bioethical, and legal implications of the technique have been debated, particularly when it is used to select features that are not related to serious diseases. Although several initiatives have attempted to achieve regulatory harmonization, the diversity of healthcare services available and the presence of cultural differences have hampered attempts to achieve this goal. Thus, in different countries, the provision of PGD and regulatory frameworks reflect the perceptions of scientific groups, legislators, and society regarding this technology. In Brazil, several texts have been analyzed by the National Congress to regulate the use of assisted reproduction technologies. Legislative debates, however, are not conclusive, and limited information has been published on how PGD is specifically regulated. The country requires the development of new regulatory standards to ensure adequate access to this technology and to guarantee its safe practice. This study examined official documents published on PGD regulation in Brazil and demonstrated how little direct oversight of PGD currently exists. It provides relevant information to encourage reflection on a particular regulation model in a Brazilian context, and should serve as part of the basis to enable further reform of the clinical practice of PGD in the country.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.