904 resultados para BARRIER-LAYER


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The classical treatment of rough wall turbulent boundary layers consists in determining the effect the roughness has on the mean velocity profile. This effect is usually described in terms of the roughness function delta U+. The general implication is that different roughness geometries with the same delta U+ will have similar turbulence characteristics, at least at a sufficient distance from the roughness elements. Measurements over two different surface geometries (a mesh roughness and spanwise circular rods regularly spaced in the streamwise direction) with nominally the same delta U+ indicate significant differences in the Reynolds stresses, especially those involving the wall-normal velocity fluctuation, over the outer region. The differences are such that the Reynolds stress anisotropy is smaller over the mesh roughness than the rod roughness. The Reynolds stress anisotropy is largest for a smooth wall. The small-scale anisotropy and interniittency exhibit much smaller differences when the Taylor microscale Reynolds number and the Kolmogorov-normalized mean shear are nominally the same. There is nonetheless evidence that the small-scale structure over the three-dimensional mesh roughness conforms more closely with isotropy than that over the rod-roughened and smooth walls.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A theory for the description of turbulent boundary layer flows over surfaces with a sudden change in roughness is considered. The theory resorts to the concept of displacement in origin to specify a wall function boundary condition for a kappa-epsilon model. An approximate algebraic expression for the displacement in origin is obtained from the experimental data by using the chart method of Perry and Joubert(J.F.M., vol. 17, pp. 193-122, 1963). This expression is subsequently included in the near wall logarithmic velocity profile, which is then adopted as a boundary condition for a kappa-epsilon modelling of the external flow. The results are compared with the lower atmospheric observations made by Bradley(Q. J. Roy. Meteo. Soc., vol. 94, pp. 361-379, 1968) as well as with velocity profiles extracted from a set of wind tunnel experiments carried out by Avelino et al.( 7th ENCIT, 1998). The measurements are found to be in good agreement with the theoretical computations. The skin-friction coefficient was calculated according to the chart method of Perry and Joubert(J.F.M., vol. 17, pp. 193-122, 1963) and to a balance of the integral momentum equation. In particular, the growth of the internal boundary layer thickness obtained from the numerical simulation is compared with predictions of the experimental data calculated by two methods, the "knee" point method and the "merge" point method.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Non-linear functional representation of the aerodynamic response provides a convenient mathematical model for motion-induced unsteady transonic aerodynamic loads response, that accounts for both complex non-linearities and time-history effects. A recent development, based on functional approximation theory, has established a novel functional form; namely, the multi-layer functional. For a large class of non-linear dynamic systems, such multi-layer functional representations can be realised via finite impulse response (FIR) neural networks. Identification of an appropriate FIR neural network model is facilitated by means of a supervised training process in which a limited sample of system input-output data sets is presented to the temporal neural network. The present work describes a procedure for the systematic identification of parameterised neural network models of motion-induced unsteady transonic aerodynamic loads response. The training process is based on a conventional genetic algorithm to optimise the network architecture, combined with a simplified random search algorithm to update weight and bias values. Application of the scheme to representative transonic aerodynamic loads response data for a bidimensional airfoil executing finite-amplitude motion in transonic flow is used to demonstrate the feasibility of the approach. The approach is shown to furnish a satisfactory generalisation property to different motion histories over a range of Mach numbers in the transonic regime.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present work shows how thick boundary layers can be produced in a short wind tunnel with a view to simulate atmospheric flows. Several types of thickening devices are analysed. The experimental assessment of the devices was conducted by considering integral properties of the flow and the spectra: skin-friction, mean velocity profiles in inner and outer co-ordinates and longitudinal turbulence. Designs based on screens, elliptic wedge generators, and cylindrical rod generators are analysed. The paper describes in detail the experimental arrangement, including the features of the wind tunnel and of the instrumentation. The results are compared with experimental data published by other authors and with naturally developed flows.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the thesis is to study cerium oxide thin films grown by the atomic layer deposition (ALD) for soot removal. Cerium oxide is one of the most important heterogeneous catalysts and can be used in particulate filters and sensors in a diesel exhaust pipe. Its redox/oxidation properties are a key factor in soot oxidation. Thus, the cerium oxide coating can help to keep particulate filters and sensors clean permanently. The literature part of the thesis focuses on the soot removal, introducing the origin and structure of soot, reviewing emissions standards for diesel particulate matter, and presenting methods and catalysts for soot removal. In the experimental part the optimal ALD conditions for cerium oxide were found, the structural properties of cerium oxide thin films were analyzed, and the catalytic activity of the cerium oxide for soot oxidation was investigated. Studying ALD growth conditions of cerium oxide films and determining their critical thickness range are important to maximize the catalytic performance operating at comparatively low temperature. It was found that the cerium oxide film deposited at 300 °C with 2000 ALD cycles had the highest catalytic activity. Although the activity was still moderate and did not decrease the soot oxidation temperature enough for a real-life application. The cerium oxide thin film deposited at 300 °C has a different crystal structure, surface morphology and elemental composition with a higher Ce3+ concentration compared to the films deposited at lower temperatures. The different properties of the cerium oxide thin film deposited at 300 °C increase the catalytic activity most likely due to higher surface area and addition of the oxygen vacancies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The thesis is devoted to a theoretical study of resonant tunneling phenomena in semiconductor heterostructures and nanostructures. It considers several problems relevant to modern solid state physics. Namely these are tunneling between 2D electron layers with spin-orbit interaction, tunnel injection into molecular solid material, resonant tunnel coupling of a bound state with continuum and resonant indirect exchange interaction mediated by a remote conducting channel. A manifestation of spin-orbit interaction in the tunneling between two 2D electron layers is considered. General expression is obtained for the tunneling current with account of Rashba and Dresselhaus types of spin-orbit interaction and elastic scattering. It is demonstrated that the tunneling conductance is very sensitive to relation between Rashba and Dresselhaus contributions and opens possibility to determine the spin-orbit interaction parameters and electron quantum lifetime in direct tunneling experiments with no external magnetic field applied. A microscopic mechanism of hole injection from metallic electrode into organic molecular solid (OMS) in high electric field is proposed for the case when the molecules ionization energy exceeds work function of the metal. It is shown that the main contribution to the injection current comes from direct isoenergetic transitions from localized states in OMS to empty states in the metal. Strong dependence of the injection current on applied voltage originates from variation of the number of empty states available in the metal rather than from distortion of the interface barrier. A theory of tunnel coupling between an impurity bound state and the 2D delocalized states in the quantum well (QW) is developed. The problem is formulated in terms of Anderson-Fano model as configuration interaction between the carrier bound state at the impurity and the continuum of delocalized states in the QW. An effect of this interaction on the interband optical transitions in the QW is analyzed. The results are discussed regarding the series of experiments on the GaAs structures with a -Mn layer. A new mechanism of ferromagnetism in diluted magnetic semiconductor heterosructures is considered, namely the resonant enhancement of indirect exchange interaction between paramagnetic centers via a spatially separated conducting channel. The underlying physical model is similar to the Ruderman-Kittel-Kasuya-Yosida (RKKY) interaction; however, an important difference relevant to the low-dimensional structures is a resonant hybridization of a bound state at the paramagnetic ion with the continuum of delocalized states in the conducting channel. An approach is developed, which unlike RKKY is not based on the perturbation theory and demonstrates that the resonant hybridization leads to a strong enhancement of the indirect exchange. This finding is discussed in the context of the known experimental data supporting the phenomenon.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tool center point calibration is a known problem in industrial robotics. The major focus of academic research is to enhance the accuracy and repeatability of next generation robots. However, operators of currently available robots are working within the limits of the robot´s repeatability and require calibration methods suitable for these basic applications. This study was conducted in association with Stresstech Oy, which provides solutions for manufacturing quality control. Their sensor, based on the Barkhausen noise effect, requires accurate positioning. The accuracy requirement admits a tool center point calibration problem if measurements are executed with an industrial robot. Multiple possibilities are available in the market for automatic tool center point calibration. Manufacturers provide customized calibrators to most robot types and tools. With the handmade sensors and multiple robot types that Stresstech uses, this would require great deal of labor. This thesis introduces a calibration method that is suitable for all robots which have two digital input ports free. It functions with the traditional method of using a light barrier to detect the tool in the robot coordinate system. However, this method utilizes two parallel light barriers to simultaneously measure and detect the center axis of the tool. Rotations about two axes are defined with the center axis. The last rotation about the Z-axis is calculated for tools that have different width of X- and Y-axes. The results indicate that this method is suitable for calibrating the geometric tool center point of a Barkhausen noise sensor. In the repeatability tests, a standard deviation inside robot repeatability was acquired. The Barkhausen noise signal was also evaluated after recalibration and the results indicate correct calibration. However, future studies should be conducted using a more accurate manipulator, since the method employs the robot itself as a measuring device.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Työn aiheena oli tutkia vaahdon soveltuvuutta ohuiden päällystyskerrosten applikointiin paperin tai kartongin pinnalle. Paperia ja kartonkia päällystetään teollisessa mittakaavassa eri menetelmillä, mutta niille kaikille yhteistä on päällystyspastan laimentaminen vedellä ennen applikointia ja laimennusveden haihduttaminen applikoinnin jälkeen päällysteen asettamiseksi. Laimennus on tärkeää pastan komponenttien tasaisen levittämisen vuoksi, mutta veden haihduttaminen kuluttaa valtavasti energiaa. Tekstiiliteollisuudessa on saavutettu merkittäviä säästöjä kuivausenergiassa korvaamalla laajalti vedellä laimentaminen vaahdottamisella. Diplomityön kirjallisessa osassa käytiin läpi vaahdon kemiallisia ja fysikaalisia ominaisuuksia sekä selvitettiin mitä kemikaaleja ja laitteita vaahdotukseen käytetään. Lisäksi luotiin katsaus vaahtoprosessien käyttöön tekstiiliteollisuudessa ja muilla aloilla. Kokeellinen osa koostui esikokeista, joissa selvitettiin pastan koostumuksen vaikutuksia vaahtoamiseen, ja pilot-mittakaavan koeajoista, joissa esikokeiden tuloksia hyödynnettiin. Esikokeissa huomiota kiinnitettiin varsinkin eri polyvinyylialkoholien (PVA) seosten erinomaiseen vaahtoavuuteen. Pilot-koeajoissa vaahtopäällystys vaikutti lupaavalta menetelmältä, joskaan täysin tyydyttävää päällystystulosta ei saavutettu. Suurimpana ongelmana esiintyi ilman pääseminen pohjapaperin ja päällysteen väliin ja siitä seuraava huono päällystejälki. Toisen ongelmakokonaisuuden muodostivat päällysteeseen jäävät reiät. Vaahtopäällystys vaikuttaa lupaavalta tekniikalta ohuiden päällystekerrosten applikointiin, mutta pastareseptejä tulee optimoida ja ratkaista päällysteen alle pääsevän ilman ongelma.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The cortical layer 1 contains mainly small interneurons, which have traditionally been classified according to their axonal morphology. The dendritic morphology of these cells, however, has received little attention and remains ill defined. Very little is known about how the dendritic morphology and spatial distribution of these cells may relate to functional neuronal properties. We used biocytin labeling and whole cell patch clamp recordings, associated with digital reconstruction and quantitative morphological analysis, to assess correlations between dendritic morphology, spatial distribution and membrane properties of rat layer 1 neurons. A total of 106 cells were recorded, labeled and subjected to morphological analysis. Based on the quantitative patterns of their dendritic arbor, cells were divided into four major morphotypes: horizontal, radial, ascendant, and descendant cells. Descendant cells exhibited a highly distinct spatial distribution in relation to other morphotypes, suggesting that they may have a distinct function in these cortical circuits. A significant difference was also found in the distribution of firing patterns between each morphotype and between the neuronal populations of each sublayer. Passive membrane properties were, however, statistically homogeneous among all subgroups. We speculate that the differences observed in active membrane properties might be related to differences in the synaptic input of specific types of afferent fibers and to differences in the computational roles of each morphotype in layer 1 circuits. Our findings provide new insights into dendritic morphology and neuronal spatial distribution in layer 1 circuits, indicating that variations in these properties may be correlated with distinct physiological functions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A method for determining aflatoxins B1 (AFB1), B2 (AFB2),G1 (AFG1) andG2 (AFG2) in maize with florisil clean up was optimised aiming at one-dimensional thin layer chromatography (TLC) analysis with visual and densitometric quantification. Aflatoxins were extracted with chloroform: water (30:1, v/v), purified through florisil cartridges, separated on TLC plate, detected and quantified by visual and densitometric analysis. The in-house method performance characteristics were determined by using spiked, naturally contaminated maize samples, and certified reference material. The mean recoveries for aflatoxins were 94.2, 81.9, 93.5 and 97.3% in the range of 1.0 to 242 µg/kg for AFB1, 0.3 to 85mg/kg for AFB2, 0.6 to 148mg/kg for AFG1 and 0.6 to 140mg/kg for AFG2, respectively. The correlation values between visual and densitometric analysis for spiked samples were higher than 0.99 for AFB1, AFB2, AFG1 and 0.98 for AFG2. The mean relative standard deviations (RSD) for spiked samples were 16.2, 20.6, 12.8 and 16.9% for AFB1, AFB2, AFG1 and AFG2, respectively. The RSD of the method for naturally contaminated sample (n = 5) was 16.8% for AFB1 and 27.2% for AFB2. The limits of detection of the method (LD) were 0.2, 0.1, 0.1 and 0.1mg/kg and the limits of quantification (LQ) were 1.0, 0.3, 0.6 and 0.6mg/kg for AFB1, AFB2, AFG1 and AFG2, respectively.