949 resultados para sympathetic dystrophy


Relevância:

10.00% 10.00%

Publicador:

Resumo:

We investigate whether arterial baroreceptors mediate the training-induced blood pressure fall and resting bradycardia in hypertensive (SHR) and normotensive rats (WKY). Male SHR and WKY rats, submitted to sino-aortic denervation (SAD) or sham surgery (SHAM group), were allocated to training (T; 55% of maximal exercise capacity) or sedentary (S) protocols for 3 months. Rats were instrumented with arterial and venous catheters for haemodynamic measurements at rest (power spectral analysis) and baroreceptor testing. Kidney and skeletal muscles were processed for morphometric analysis of arterioles. Elevated mean arterial pressure (MAP) and heart rate (HR) in SHAM SHRS were accompanied by increased sympathetic variability and arteriolar wall/lumen ratio [+3.4-fold on low-frequency (LF) power and +70%, respectively, versus WKYS, P < 0.05]. Training caused significant HR (similar to 9% in WKY and SHR) and MAP reductions (-8% in the SHR), simultaneously with improvement of baroreceptor reflex control of HR (SHR and WKY), LF reduction (with a positive correlation between LF power and MAP levels in the SHR) and normalization of wall/lumen ratio of the skeletal muscle arterioles (SHR only). In contrast, SAD increased pressure variability in both strains of rats, causing reductions in MAP (-13%) and arteriolar wall/lumen ratio (-35%) only in the SHRS. Training effects were completely blocked by SAD in both strains; in addition, after SAD the resting MAP and HR and the wall/lumen ratio of skeletal muscle arterioles were higher in SHRT versus SHRS and similar to those of SHAM SHRS. The lack of training-induced effects in the chronic absence of baroreceptor inputs strongly suggests that baroreceptor signalling plays a decisive role in driving beneficial training-induced cardiovascular adjustments.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: Obesity and obstructive sleep apnea (OSA) are both associated with the prevalence of major cardiovascular illnesses and certain common factors they are considered responsible for, such as stress oxidative increase, sympathetic tonus and resistance to insulin. Objective: The aim of the present study was to compare the effect of continuous positive airway pressure (CPAP) on oxidative stress and adiponectin levels in obese patients with and without OSA. Methods: Twenty-nine obese patients were categorized into 3 groups: group 1: 10 individuals without OSA (apnea-hypopnea index, AHI <= 5) who did not have OSA diagnosed at polysomnography; group 2: 10 patients with moderate to severe OSA (AHI >= 20) who did not use CPAP; group 3: 9 patients with moderate to severe OSA (AHI >= 20) who used CPAP. Results: Group 3 showed significant differences before and after the use of CPAP, in the variables of diminished production of superoxide, and increased nitrite and nitrate synthesis and adiponectin levels. Positive correlations were seen between the AHI and the superoxide production, between the nitrite and nitrate levels and the adiponectin levels, between superoxide production and the HOMA-IR, and between AHI and the HOMA-IR. Negative correlations were found between AHI and the nitrite and nitrate levels, between the superoxide production and that of nitric oxide, between the superoxide production and the adiponectin levels, between AHI and the adiponectin levels, and between the nitrite and nitrate levels and the HOMA-IR. Conclusions: This study demonstrates that the use of CPAP can reverse the increased superoxide production, the diminished serum nitrite, nitrate and plasma adiponectin levels, and the metabolic changes existing in obese patients with OSA. Copyright (C) 2009 S. Karger AG, Basel

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: Retinitis pigmentosa (RP) is a group of genetically heterogeneous diseases with progressive degeneration of the retina. The condition can be inherited as an autosomal dominant, autosomal recessive, and X-linked trait. Methods: We report on two female twin pairs. One twin of each pair is affected with RP, the other twin is unaffected, both clinically and functionally. Molecular analysis in both twins included zygosity determination, arrayed primer extension chip analysis for autosomal recessive and dominant RP, sequencing of the entire RPGR gene, and analysis of X-chromosome inactivation status. Results: Both unrelated twin pairs were genetically identical. Of the potential pathogenetic mechanisms, skewed X-inactivation was excluded on leukocytes. Autosomal recessive RP and autosomal dominant RP arrayed primer extension chip analysis result was completely normal, excluding known mutations in known genes as the cause of disease in the affected twins. Sequencing excluded mutations in RPGR. A postzygotic recessive or dominant genetic mutation of an RP gene is not impossible. A postfertilization error as a potential cause of uniparental isodisomy is unlikely albeit not entirely impossible. Conclusion: The authors report on the second and third unrelated identical twin pair discordant for RP. The exact cause of the condition and the explanation of the clinical discordance remain elusive. RETINA 31:1164-1169, 2011

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Significant controversies surround the optimal treatment of primary hyperhidrosis of the hands, axillae, feet, and face. The world`s literature on hyperhidrosis from 1991 to 2009 was obtained through PubMed. There were 1,097 published articles, of which 102 were clinical trials. Twelve were randomized clinical trials and 90 were nonrandomized comparative studies. After review and discussion by task force members of The Society of Thoracic Surgeons` General Thoracic Workforce, expert consensus was reached from which specific treatment strategies are suggested. These studies suggest that primary hyperhidrosis of the extremities, axillae or face is best treated by endoscopic thoracic sympathectomy (ETS). Interruption of the sympathetic chain can be achieved either by electrocautery or clipping. An international nomenclature should be adopted that refers to the rib levels (R) instead of the vertebral level at which the nerve is interrupted, and how the chain is interrupted, along with systematic pre and postoperative assessments of sweating pattern, intensity and quality-of-life. The recent body of literature suggests that the highest success rates occur when interruption is performed at the top of R3 or the top of R4 for palmar-only hyperhidrosis. R4 may offer a lower incidence of compensatory hyperhidrosis but moister hands. For palmar and axillary, palmar, axillary and pedal and for axillary-only hyperhidrosis interruptions at R4 and R5 are recommended. The top of R3 is best for craniofacial hyperhidrosis. (Ann Thorac Surg 2011;91:1642-8) (C) 2011 by The Society of Thoracic Surgeons

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objectives/Hypothesis: To analyze clinical and epidemiological features of neck nerve schwannomas, with emphasis on the neurologic outcome after surgical excision sparing as much of nerve fibers as possible with enucleation technique. Study Design: Retrospective study. Methods: Review of medical records from 1987 to 2006 of patients with neck nerve schwannomas, treated in a single institution. Results: Twenty-two patients were identified. Gender distribution was equal and age ranged from 15 to 61 years (mean: 38.6 years). Seven vagal, four brachial plexus, four sympathetic trunk, three cervical plexus, and two lesions on other sites could be identified. Most common symptom was neck mass. Local or irradiated pain also occurred in five cases. Median growing rate of tumors was 3 mm per year. Nerve paralysis was noted twice (a vagal schwannoma and a hypoglossal paralysis compressed by a vagal schwannoma). Different techniques were employed, and seven out of nine patients kept their nerve function (78%) after enucleation. No recurrence was observed in follow-up. Conclusions: Schwannomas should be treated surgically because of its growing potential, leading to local and neural compression symptoms. When possible, enucleation, which was employed in 10 patients of this series, is the recommended surgical option, allowing neural function preservation or restoration in most instances. This is especially important in the head and neck, where denervation may have a significant impact on the quality of life.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Obesity is associated with increased sympathetic activity and higher mortality. Treatment of this condition is often frustrating. Roux-en-Y gastric bypass is the most effective technique nowadays for treatment of obesity. The aim of the present study is to assess the effects of this surgery on the cardiac autonomic activity, including the influence of gender and age, through heart rate variability (HRV) analysis. The study group consisted of 71 obese patients undergoing gastric bypass. Time domain measures of HRV, obtained from 24-h Holter recordings, were evaluated before and 6 months after surgery, and the results were compared. Percentage of interval differences of successive normal sinus beats greater than 50 ms (pNN50) and square root of the mean squared differences of successive normal sinus beat intervals (rMSSD) was used to estimate the short-term components of HRV, related to the parasympathetic activity. Standard deviation of intervals between all normal sinus beats (SDNN) was related to overall HRV. SDNN, pNN50, and rMSSD showed significant increase 6 months after surgery (p < 0.001, p = 0.001 and p = 0.002, respectively). Men presented a greater increase of SDNN than women (p = 0.006) during the follow-up. There was a difference in rMSSD evolution for age groups (p = 0.002). Only younger patients presented significant increase of rMSSD. Overall HRV increased 6 months after surgery; this increase was more evident in men. Cardiac parasympathetic activity increased also, but in younger patients only.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Exercise training has an important role in the prevention and treatment of hypertension, but its effects on the early metabolic and hemodynamic abnormalities observed in normotensive offspring of hypertensive parents (FH+) have not been studied. We compared high-intensity interval (aerobic interval training, AIT) and moderate-intensity continuous exercise training (CMT) with regard to hemodynamic, metabolic and hormonal variables in FH+ subjects. Forty-four healthy FH+ women (25.0+/-4.4 years) randomized to control (ConFH+) or to a three times per week equal-volume AIT (80-90% of VO(2MAX)) or CMT (50-60% of VO(2MAX)) regimen, and 15 healthy women with normotensive parents (ConFH-; 25.3+/-3.1 years) had their hemodynamic, metabolic and hormonal variables analyzed at baseline and after 16 weeks of follow-up. Ambulatorial blood pressure (ABP), glucose and cholesterol levels were similar among all groups, but the FH+ groups showed higher insulin, insulin sensitivity, carotid-femoral pulse wave velocity (PWV), norepinephrine and endothelin-1 (ET-1) levels and lower nitrite/ nitrate (NOx) levels than ConFH- subjects. AIT and CMT were equally effective in improving ABP (P<0.05), insulin and insulin sensitivity (P<0.001); however, AIT was superior in improving cardiorespiratory fitness (15 vs. 8%; P<0.05), PWV (P<0.01), and BP, norepinephrine, ET-1 and NOx response to exercise (P<0.05). Exercise intensity was an important factor in improving cardiorespiratory fitness and reversing hemodynamic, metabolic and hormonal alterations involved in the pathophysiology of hypertension. These findings may have important implications for the exercise training programs used for the prevention of inherited hypertensive disorder. Hypertension Research (2010) 33, 836-843; doi:10.1038/hr.2010.72; published online 7 May 2010

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background-Peculiar aspects of Chagas cardiomyopathy raise concerns about efficacy and safety of sympathetic blockade. We studied the influence of beta-blockers in patients with Chagas cardiomyopathy. Methods and Results-We examined REMADHE trial and grouped patients according to etiology (Chagas versus non-Chagas) and beta-blocker therapy. Primary end point was all-cause mortality or heart transplantation. Altogether 456 patients were studied; 27 (5.9%) were submitted to heart transplantation and 202 (44.3%) died. Chagas etiology was present in 68 (14.9%) patients; they had lower body mass index (24.1+/-4.1 versus 26.3+/-5.1, P=0.001), smaller end-diastolic left ventricle diameter (6.7+/-1.0 mm versus 7.0+/-0.9 mm, P=0.001), smaller proportion of beta-blocker therapy (35.8% versus 68%, P<0.001), and higher proportion of spironolactone therapy (74.6% versus 57.8%, P=0.003). Twenty-four (35.8%) patients with Chagas disease were under beta-blocker therapy and had lower serum sodium (136.6+/-3.1 versus 138.4+/-3.1 mEqs, P=0.05) and lower body mass index (22.5+/-3.3 versus 24.9+/-4.3, P=0.03) compared with those who received beta-blockers. Survival was lower in patients with Chagas heart disease as compared with other etiologies. When only patients under beta-blockers were considered, the survival of patients with Chagas disease was similar to that of other etiologies. The survival of patients with beta-blockers was higher than that of patients without beta-blockers. In Cox regression model, left ventricle end-diastolic diameter (hazard ratio, 1.78; CI, 1.15 to 2.76; P=0.009) and beta-blockers (hazard ratio, 0.37; CI, 0.14 to 0.97; P=0.044) were associated with better survival. Conclusions-Our study suggests that beta-blockers may have beneficial effects on survival of patients with heart failure and Chagas heart disease and warrants further investigation in a prospective, randomized trial.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Study Objectives: To test the effects of exercise training on sleep and neurovascular control in patients with systolic heart failure with and without sleep disordered breathing. Design: Prospective interventional study. Setting: Cardiac rehabilitation and exercise physiology unit and sleep laboratory. Patients: Twenty-five patients with heart failure, aged 42 to 70 years, and New York Heart Association Functional Class I-III were divided into 1 of 3 groups: obstructive sleep apnea (n = 8), central sleep apnea (n 9) and no sleep apnea (n = 7). Interventions: Four months of no-training (control) followed by 4 months of an exercise training program (three 60-minute, supervised, exercise sessions per week). Measures and Results: Sleep (polysomnography), microneurography, forearm blood flow (plethysmography), peak VO(2). and quality of life were evaluated at baseline and at the end of the control and trained periods. No significant changes occurred in the control period. Exercise training reduced muscle sympathetic nerve activity (P < 0.001) and increased forearm blood flow (P < 0.01), peak VO(2) (P < 0.01), and quality of life (P < 0.01) in all groups, independent of the presence of sleep apnea. Exercise training improved the apnea-hypopnea index, minimum O(2) saturation, and amount stage 3-4 sleep (P < 0.05) in patients with obstructive sleep apnea but had no significant effects in patients with central sleep apnea. Conclusions. The beneficial effects of exercise training on neurovascular function, functional capacity, and quality of life in patients with systolic dysfunction and heart failure occurs independently of sleep disordered breathing. Exercise training lessens the severity of obstructive sleep apnea but does not affect central sleep apnea in patients with heart failure and sleep disordered breathing.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Dias RG, Alves MJ, Pereira AC, Rondon MU, dos Santos MR, Krieger JE, Krieger MH, Negrao CE. Glu298Asp eNOS gene polymorphism causes attenuation in nonexercising muscle vasodilatation. Physiol Genomics 37: 99-107, 2009. First published January 21, 2009; doi:10.1152/physiolgenomics.90368.2008.-The influence of Glu298Asp endothelial nitric oxide synthase (eNOS) polymorphism in exercise-induced reflex muscle vasodilatation is unknown. We hypothesized that nonexercising forearm blood flow (FBF) responses during handgrip isometric exercise would be attenuated in individuals carrying the Asp298 allele. In addition, these responses would be mediated by reduced eNOS function and NO-mediated vasodilatation or sympathetic vasoconstriction. From 287 volunteers previously genotyped, we selected 33 healthy individuals to represent three genotypes: Glu/Glu [n = 15, age 43 +/- 3 yr, body mass index (BMI) 22.9 +/- 0.3 kg/m(2)], Glu/Asp (n = 9, age 41 +/- 3 yr, BMI 23.7 +/- 1.0 kg/m(2)), and Asp/Asp (n = 9, age 40 +/- 4 yr, BMI 23.5 +/- 0.9 kg/m(2)). Heart rate (HR), mean blood pressure (MBP), and FBF (plethysmography) were recorded for 3 min at baseline and 3 min during isometric handgrip exercise. Baseline HR, MBP, FBF, and forearm vascular conductance (FVC) were similar among genotypes. FVC responses to exercise were significantly lower in Asp/Asp when compared with Glu/Asp and Glu/Glu (Delta = 0.07 +/- 0.14 vs. 0.64 +/- 0.20 and 0.57 +/- 0.09 units, respectively; P = 0.002). Further studies showed that intra-arterial infusion of N(G)-monomethyl-L-arginine (L-NMMA) did not change FVC responses to exercise in Asp/Asp, but significantly reduced FVC in Glu/Glu (Delta = 0.79 +/- 0.14 vs. 0.14 +/- 0.09 units). Thus the differences between Glu/Glu and Asp/Asp were no longer observed (P = 0.62). L-NMMA + phentolamine increased similarly FVC responses to exercise in Glu/Glu and Asp/Asp (P = 0.43). MBP and muscle sympathetic nerve activity increased significant and similarly throughout experimental protocols in Glu/Glu and Asp/Asp. Individuals who are homozygous for the Asp298 allele of the eNOS enzyme have attenuated nonexercising muscle vasodilatation in response to exercise. This genotype difference is due to reduced eNOS function and NO-mediated vasodilatation, but not sympathetic vasoconstriction.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study examined the impact of computer and assistive device use on the employment status and vocational modes of people with physical disabilities in Australia. A survey was distributed to people over 15 years in age with physical disabilities living in the Brisbane area. Responses were received from 82 people, including those with spinal cord injuries, cerebral palsy and muscular dystrophy. Of respondents 46 were employed, 22 were unemployed, and 12 were either students or undertaking voluntary work. Three-quarters of respondents used a computer in their occupations, while 15 used assistive devices. Using logistic regression analysis it was found that gender, education, level of computer skill and computer training were significant predictors of employment outcomes. Neither the age of respondent nor use of assistive software were significant predictors. From information obtained in this study guidelines for a training programme designed to maximize the employability of people with physical disabilities were developed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objective To assess MHC I and II expressions in muscle fibres of juvenile dermatomyositis (JDM) and compare with the expression in polymyositis (PM), dermatomyositis (DM) and dystrophy. Patients and methods Forty-eight JDM patients and 17 controls (8 PM, 5 DM and 4 dystrophy) were studied. The mean age at disease onset was 7.1 +/- 3.0 years and the mean duration of weakness before biopsy was 9.4 +/- 12.9 months. Routine histochemistry and immunohistochemistry (StreptABComplex/HRP) for MHC I and II (Dakopatts) were performed on serial frozen muscle sections in all patients. Mann-Whitney, Kruskal Wallis, chi-square and Fisher`s exact statistical methods were used. Results MHC I expression was positive in 47 (97.9%) JDM cases. This expression was observed independent of time of disease corticotherapy previous to muscle biopsy and to the grading of inflammation observed in clinical, laboratorial and histological parameters. The expression of MHC I was similar on JDM, PM and DM, and lower in dystrophy. On the other hand, MHC II expression was positive in just 28.2% of JDM cases was correlated to histological features as inflammatory infiltrate, increased connective tissue and VAS for global degree of abnormality (p < 0.05). MCH II expression was similar in DM/PM and lower in JDM and dystrophy, and it was based on the frequency of positive staining rather than to the degree of the MCH II expression. Conclusions MHC I expression in muscle fibres is a premature and late marker of JDM patient independent to corticotherapy, and MHC II expression was lower in JDM than in PM and DM.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Introduction Associations between systemic lupus erythematosus (SLE) and primary immunodeficiencies (PIDs) were analyzed to gain insight into the physiopathology of SLE. Some PIDs have been consistently associated with SLE or lupus-like manifestations: (a) homozygous deficiencies of the early components of the classical complement pathway in the following decreasing order: in C1q, 93% of affected patients developed SLE; in C4, 75%; in C1r/s, 57%; and in C2, up to 25%; (b) female carriers of X-linked chronic granulomatous disease allele; and (c) IgA deficiency, present in around 5% of juvenile SLE. Discussion In the first two groups, disturbances of cellular waste-disposal have been proposed as the main mechanisms of pathogenesis. On the other hand and very interestingly, there are PIDs systematically associated with several autoimmune manifestations in which SLE has not been described, such as autoimmune polyendocrinopathy candidiasis ectodermal dystrophy (APECED), immunedys-regulation polyendocrinopathy enteropathy X-linked (IPEX), and autoinumme lymphoproliferative syndrome (ALPS), suggesting that mechanisms considered as critical players for induction and maintenance of tolerance to autoantigens, such as (1) AME-mediated thymic negative selection of lymphocytes, (2) Foxp3+ regulatory T cell-mediated peripheral tolerance, and (3) deletion of auto-reactive lymphocytes by Fas-mediated apoptosis, could not be relevant in SLE physiopathology. The non-description of SLE and neither the most characteristic SLE clinical features among patients with agammaglobulinemia are also interesting observations, which reinforce the essential role of B lymphocytes and antibodies for SLE pathogenesis. Conclusion Therefore, monogenic PIDs represent unique and not fully explored human models for unraveling components of the conundrum represented by the physiopathology of SLE, a prototypical polygenic disease.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background Primary Immunodeficiencies (PIDs) represent unique opportunities to understand the operation of the human immune system. Accordingly, PIDs associated with autoimmune manifestations provide insights into the pathophysiology of autoimmunity as well as into the genetics of autoimmune diseases (AID). Epidemiological data show that there are PIDs systematically associated with AID, such as immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX), Omenn syndrome, autoinunune polyendocrinopathy-candidiasis-ectodertnal dystrophy (APECED), autoinumine lymphoproliferative syndrome (ALPS), and C1q deficiency, while strong associations are seen with a handful of other deficits. Conclusion We interpret such stringent disease associations, together with a wealth of observations in experimental systems, as indicating first of all that natural tolerance to body components is an active, dominant process involving many of the components that ensure responsiveness, rather than, as previously believed, the result of the mere purge of autoreactivities. More precisely, it seems that deficits of Treg cell development, functions, numbers, and T cell receptor repertoire are among the main factors for autoimmunity pathogenesis in many (if not all) PIDs most frequently presenting with autoimmune features. Clearly, other pathophysiological mechanisms are also involved in autoimmunity, but these seem less critical in the process of self-tolerance. Comparing the clinical picture of IPEX cases with those, much less severe, of ALPS or APECED, provides some assessment of the relative importance of each set of mechanisms.