Estudo das catelicidinas no plasma seminal de garanhões e das interleucinas na resposta inflamatória pós-iseminação artificial em éguas

Pós-graduação em Medicina Veterinária - FMVZ

Criopreservação e fertilidade de espermatozoides do ejaculado e recuperados da cauda do epidídimo de garanhões subférteis

Pós-graduação em Medicina Veterinária - FMVZ

Efeitos da sexagem por citometria de fluxo sobre a composição protéica da membrana de espermatozóides bovinos

Pós-graduação em Medicina Veterinária - FMVZ

Indução a espermiação do mandi-pintado, Pimelodus britskii no período reprodutivo (Teleostei: Pimelodidae)

Pós-graduação em Aquicultura - FCAV

Parâmetros seminais, ultraestruturais, criopreservação e androgênese de espécies do gênero Brycon ameaçadas de extinção

Pós-graduação em Aquicultura - FCAV

Cola de fibrina derivada de veneno de cobra e processo para sua preparação

A presente invenção trata de um produto denominado cola de fibrina, de grande eficácia, utilizada em várias indica$ões na área médica, bem como de um processo para sua preparação. A cola de fibrina derivada de veneno de cobra, segundo a presente invenção compreende uma SOLUÇÃO I e uma SOLUÇÃO II, consistindo a SOLUÇÃO I de uma fração de veneno de cobra liofilizado, diluída em água bidestilada até atingir concentração entre 80-90 microgramas/ml, sendo para cada parte desta diluição adicionados vinte partes de uma solução de um sal de cálcio a 400 microgramas/ml e, consistindo a SOLUÇÃO II em um crioprecipitado obtido a partir de plasma fresco congelado a -20°C, o qual deve conter, em média, 150-250mg de fibrogênio, 80-120 unidades do fator VIII, 20-30% do fator XIII, 40-70 unidades do fator "von Willibrand" e de 50-60mg de fibronectina.

The seasonal and ovarian status effects on in vitro production of domestic cat embryos between Equator and Tropic of Capricorn

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Aspectos reprodutivos, morfologia dos gametas e desenvolvimento embrionário de Astyanax altiparanae Garutti & Britski (Teleostei, Characidae)

Pós-graduação em Aquicultura - FCAV

Embriões bovinos produzidos in vitro com espermatozoides sexados por citometria de fluxo: avaliação do desenvolvimento embrionário e da expressão de genes candidatos ao reconhecimento da gestação

Pós-graduação em Genética e Melhoramento Animal - FCAV

Capacidade de ligação dos espermatozóides de epidídimo de equinos às células da tuba uterina cultivadas in vitro

Pós-graduação em Biotecnologia Animal - FMVZ

Efeito da administração da sulpirida no desenvolvimento folicular em éguas

Pós-graduação em Biotecnologia Animal - FMVZ

Degenerative joint disease in cattle and buffaloes in the Amazon region: a retrospective study

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Remoção da adesividade em ovos de Pseudoplatystoma fasciatum

Pós-graduação em Aquicultura - FCAV

Aspectos reprodutivos e sociais e resistência óssea em ratos machos submetidos ao exercício físico e/ou a um anabolizante esteróide

Nowadays the regular practice of sports is known as a way to obtain a better quality of life. On the other hand, the media has been distorting this idea, determining the ideal body as the hypertrophy phenotype. It is well known that the genetic factor does not allow all individuals to have this body shape. Besides the fact that, the anxiety of these people in obtain quick results, as one of the globalization’s consequence, make use of anabolic steroid to achieve this goal. However the bodybuilding or the strength muscle gain, make anabolic steroids users abuse and in major cases the users do not know the side effects. In front of these considerations, the present study evaluated the effects of the treatment with anabolic steroids and/or high intensity physical training on the corporal developing, the reproductive organs, bone parameters (strength and bone deformation) and seminal parameters as well the social behavior (aggressiveness). In other to obtain the experimental group, male Wistar rats were used, with 75 days old. The groups were divided into: Vehicle Non-Training (NV), Anabolic Steroid-Non-Training (NA), Vehicle-Training (TV) and Anabolic Steroid-Training (TA). These rats received i.m. injections, twice a week, of anabolic steroid (5mg/kg per animal of nandrolona decanoate) or vehicle (the same volume of peanut oil per animal) and the group TV and TA were submitted to physical training three times per week, during eight weeks. The body mass, wet weight of reproductive organs, femur and semen of the different groups were measured. The aggressive test was also realized in two steps: the first, within 4 weeks of the treatment and the other step in the end of the treatment, in this period the animal was isolated. It was not observed alterations in body mass of the groups. Though it was observed a benefic effect on the maximum strength of the... (Complete abstract click electronic access below)