427 resultados para sêmen congelado


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FMVZ

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FMVZ

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Aquicultura - FCAV

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A presente invenção trata de um produto denominado cola de fibrina, de grande eficácia, utilizada em várias indica$ões na área médica, bem como de um processo para sua preparação. A cola de fibrina derivada de veneno de cobra, segundo a presente invenção compreende uma SOLUÇÃO I e uma SOLUÇÃO II, consistindo a SOLUÇÃO I de uma fração de veneno de cobra liofilizado, diluída em água bidestilada até atingir concentração entre 80-90 microgramas/ml, sendo para cada parte desta diluição adicionados vinte partes de uma solução de um sal de cálcio a 400 microgramas/ml e, consistindo a SOLUÇÃO II em um crioprecipitado obtido a partir de plasma fresco congelado a -20°C, o qual deve conter, em média, 150-250mg de fibrogênio, 80-120 unidades do fator VIII, 20-30% do fator XIII, 40-70 unidades do fator "von Willibrand" e de 50-60mg de fibronectina.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Biotecnologia Animal - FMVZ

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Biotecnologia Animal - FMVZ

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Aquicultura - FCAV

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Nowadays the regular practice of sports is known as a way to obtain a better quality of life. On the other hand, the media has been distorting this idea, determining the ideal body as the hypertrophy phenotype. It is well known that the genetic factor does not allow all individuals to have this body shape. Besides the fact that, the anxiety of these people in obtain quick results, as one of the globalization’s consequence, make use of anabolic steroid to achieve this goal. However the bodybuilding or the strength muscle gain, make anabolic steroids users abuse and in major cases the users do not know the side effects. In front of these considerations, the present study evaluated the effects of the treatment with anabolic steroids and/or high intensity physical training on the corporal developing, the reproductive organs, bone parameters (strength and bone deformation) and seminal parameters as well the social behavior (aggressiveness). In other to obtain the experimental group, male Wistar rats were used, with 75 days old. The groups were divided into: Vehicle Non-Training (NV), Anabolic Steroid-Non-Training (NA), Vehicle-Training (TV) and Anabolic Steroid-Training (TA). These rats received i.m. injections, twice a week, of anabolic steroid (5mg/kg per animal of nandrolona decanoate) or vehicle (the same volume of peanut oil per animal) and the group TV and TA were submitted to physical training three times per week, during eight weeks. The body mass, wet weight of reproductive organs, femur and semen of the different groups were measured. The aggressive test was also realized in two steps: the first, within 4 weeks of the treatment and the other step in the end of the treatment, in this period the animal was isolated. It was not observed alterations in body mass of the groups. Though it was observed a benefic effect on the maximum strength of the... (Complete abstract click electronic access below)