979 resultados para random amplified polymorphic DNA (RAPD)


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Restriction fragment length polymorphism (RFLP) is a common molecular assay used for genotyping, and it requires validated quality control procedures to prevent mistyping caused by impaired endonuclease activity. We have evaluated the usefulness of a plasmid-based internal control in RFLP assays. Results: Blood samples were collected from 102 individuals with acute myocardial infarction (AMI) and 108 non-AMI individuals (controls) for DNA extraction and laboratory analyses. The 1196C> T polymorphism in the toll-like receptor 4 (TLR4) gene was amplified by mismatched-polymerase chain reaction (PCR). Amplicons and pBluescript II SK-plasmid were simultaneously digested with endonuclease HincII. Fragments were separated on 2% agarose gels. Plasmid was completely digested using up to 55.2 nmL/L DNA solutions and 1 mu L PCR product. Nevertheless, plasmid DNA with 41.4 nM or higher concentrations was incompletely digested in the presence of 7 mL PCR product. In standardized conditions, TLR4 1196C> T variant was accurately genotyped. TLR4 1196T allele frequency was similar between AMI (3.1%) and controls (2.0%, p = 0.948). TLR4 SNP was not associated with AMI in this sample population. In conclusion, the plasmid-based control is a useful approach to prevent mistyping in RFLP assays, and it is validate for genetic association studies such as TLR4 1196C> T.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Lineage-survival oncogenes are activated by somatic DNA alterations in cancers arising from the cell lineages in which these genes play a role in normal development(1,2). Here we show that a peak of genomic amplification on chromosome 3q26.33 found in squamous cell carcinomas (SCCs) of the lung and esophagus contains the transcription factor gene SOX2, which is mutated in hereditary human esophageal malformations(3), is necessary for normal esophageal squamous development(4), promotes differentiation and proliferation of basal tracheal cells(5) and cooperates in induction of pluripotent stem cells(6-8). SOX2 expression is required for proliferation and anchorage-independent growth of lung and esophageal cell lines, as shown by RNA interference experiments. Furthermore, ectopic expression of SOX2 here cooperated with FOXE1 or FGFR2 to transform immortalized tracheobronchial epithelial cells. SOX2-driven tumors show expression of markers of both squamous differentiation and pluripotency. These characteristics identify SOX2 as a lineage-survival oncogene in lung and esophageal SCC.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objective: Prostate cancer (PCa) is the most frequent tumor in males in Brazil. Single nucleotide polymorphisms (SNP) have been demonstrated in the promoter region of matrix metalloproteinases (MMPs) genes and have been associated with development and progression of some cancers. In this study, our aim was to investigate a possible relation between polymorphism of the promoter region of the MMP2 gene and classical prognostic parameters in prostate cancer. Materials and methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by real-time polymerase chain reaction, using fluorescent probes (TaqMan). Results: In patients with tumors of a higher stage (pT3), a polymorphic allele in the MMP2 gene was more frequent (P = 0.026) than in patients with lower tumor stage. A polymorphic allele in the MMP2 gene was more frequent in Gleason >= 7 than in Gleason <= 6 (P = 0.042). Conclusions: We conclude that MMP2 polymorphism can be used together with pathological stage and Gleason score to identify patients with worse prognosis. Our results illustrate the potential use of MMP2 SNP as a molecular marker for prostate cancer. (C) 2010 Elsevier Inc. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Purpose: Prostate cancer is the most common tumor in males in Brazil. Single nucleotide polymorphisms have been demonstrated to exist in the promoter regions of matrix metalloproteinase genes and they are associated with the development and progression of some cancers. We investigated the correlation between MMP1, 2, 7 and 9 polymorphisms with susceptibility to prostate cancer, and classic prognostic parameters of prostate cancer. Materials and Methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by realtime polymerase chain reaction using TaqMan (R) fluorescent probes. Results: For the MMP1 gene the polymorphic allele was more common in the control group than in the prostate cancer group (p <0.001). For the MMP9 gene the incidence of the polymorphic homozygote genotype was higher in the prostate cancer group (p <0.001). For higher stage tumors (pT3) a polymorphic allele in the MMP2 gene was more common (p = 0.026). When considering Gleason score, the polymorphic homozygote genotype of MMP9 was more common in Gleason 6 or less tumors (p = 0.003), while a polymorphic allele in the MMP2 gene was more common in Gleason 7 or greater tumors (p = 0.042). Conclusions: MMP1 and MMP2 may protect against prostate cancer development and MMP9 may be related to higher risk. In contrast, MMP9 polymorphism was associated with a lower Gleason score and MMP2 polymorphism was associated with nonorgan confined disease.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Gene amplification occurs in Bradysia hygida salivary glands, at the end of the fourth larval instar. The hormone 20-hydroxyecdysone (20E) triggers this process, which results in DNA puff formation. Amplified genes are activated in two distinct groups. The activity of the first group is dependent on high levels of 20E, while the second group needs low hormone levels. Consequently, the salivary glands of B. hygida constitute an interesting biological model to study how 20E, and its receptors, affect gene amplification and activity. We produced polyclonal antibodies against B. hygida EcR (BhEcR). In western blots a polypeptide of about 66 kDa was detected in salivary gland extracts. The antibodies were also used for indirect immune-localization of BhEcR in polytene chromosomes. RNA-polymerase II was also immune-detected. We did not detect the receptor in chromosome C where the first and second groups of DNA puffs form during DNA puff anlage formation, but it was present during puff expansion. During the active phase of both groups of DNA puffs, RNA polymerase II co-localized with BhEcR. After puff regression, these antigens were not detected. Apparently, EcR plays a direct role in the transcription of amplified genes, but its role in gene amplification remains enigmatic.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Impaired DNA repair efficiency in systematic lupus erythematosus (SLE) patients has been reported ill some studies, mainly regarding the repair of oxidative damage, but little is known about repair kinetics towards primarily single-stranded DNA breaks. In the present study, we aimed to investigate: (a) the efficiency of SLE peripheral blood leucocytes in repairing DNA damage induced by ionizing radiation and (b) the association of DNA repair gene (XRCC1 Arg399Gln, XRCC3 Thr241Met and XRCC4 Ile401Thr) polymorphisms in SLE patients, considering the whole group, or stratified sub-groups according to clinical and laboratory features. A total of 163 SLE patients and 125 healthy control were studied. The kinetics of DNA strand break repair was evaluated by the comet assay, and genotyping for DNA repair genes was performed by PCR-RFLP. Compared with controls. SLE leucocytes exhibited decreased efficiency of DNA repair evaluated at 30 min following irradiation. A significant association with DNA repair gene polymorphisms was not observed for the whole group of SLE patients; however, the XRCC1Arg399Gln polymorphism was associated with the presence of anti-dsDNA antibody. The concomitance of two DNA repair polymorphic sites was associated with the presence of neuropsychiatric manifestations and antiphospholipid antibody syndrome. Taken together, these results indicated that SLE leucocytes repair less efficiently the radiation-induced DNA damage, and DNA repair polymorphic sites may predispose to the development of particular clinical and laboratory features. Lupus (2008) 17, 988-995.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aim of this study was to evaluate the frequency of polymorphisms in the TYMS, XRCC1, and ERCC2 DNA repair genes in pediatric patients with acute lymphoblastic leukemia using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) approaches. The study was conducted in 206 patients and 364 controls from a Brazilian population. No significant differences were observed among the analyzed groups regarding XRCC1 codon 399 and codon 194 and ERCC2 codon 751 and codon 312 polymorphisms. The TYMS 3R variant allele was significantly associated with a reduced risk of childhood ALL, represented by the sum of heterozygous and polymorphic homozygous genotypes (odds ratio 0.60; 95% confidence interval 0.37-0.99). The results suggest that polymorphism in TYMS may play a protective role against the development of childhood ALL.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

One hundred and fifty-one Erysipelothrix spp. isolates from diseased and carrier swine from Brazil were identified by PCR, submitted to serotyping and analyzed by amplified fragment length polymorphism with a single enzyme (AFLP). Reference strains from Australia and the United Kingdom were also examined. The 151 strains were classified into 18 different serotypes (1a, 1b, 2a, 2b, 4, 5, 6, 7, 8, 10, 11, 12, 15, 17, 19, 21, 24 and 25), being serotype 2b the most frequent (39.7%). By associating serotyping and PCR results, it was possible to identify 146 strains as E. rhusiopathiae and five strains as E. tonsillarum. Despite the fact that for this genus AFLP did not cluster all isolates according to serotype, origin, disease or isolation data, the execution of the technique was easy and fast, demonstrating high discriminatory power. The results produced by the AFLP analysis of Erysipelothrix spp. could also support its use as a discriminatory tool for E. rhusiopathiae and E. tonsillarum species. (C) 2010 Elsevier B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Two different regions of the infected cell protein 4 (ICP4) gene of infectious laryngotracheitis virus (ILTV) were amplified and sequenced for characterization of field isolates and tissue culture-origin (TCO) and chicken embryo-origin (CEO) vaccine strains. Phylogenetic analysis of the two regions showed differences in nucleotide and amino acid sequences between field isolates and attenuated vaccines. The PCR-RFLP results were identical to those obtained by DNA sequencing and validated their use to differentiate ILTV strains. The approach using the sequencing of the two fragments of the ICP4 gene showed to be an efficient and practical procedure to differentiate between field isolates and vaccine strains of ILTV. (C) 2009 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We tested the hypothesis that X-linked genes determining stature which are subject to skewed or non-random X-inactivation can account for discordance in height in monozygotic female twins. Height discordant female monozygotic adult twins (20 pairs) were identified from the Australian Twin Registry, employing the selection criteria of proven monozygosity and a measured height discordance of at least 5 cm. Differential X-inactivation was examined in genomic DNA extracted from peripheral lymphocytes by estimating differential methylation of alleles at the polymorphic CAG triplet repeat of the Androgen receptor gene (XAR). There were 17/20 MZ pairs heterozygous at this locus and informative for analysis. Of these, 10/17 both had random X-inactivation, 5/17 showed identical X-inactivation patterns of non random inactivation and 2/17 (12%) showed discordant X-inactivation. There was no relationship between inactivation patterns and self-report chorionicity. We conclude that non-random X-inactivation does not appear to be a major contributor to intra-pair height discordance in female MZ twins.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Microsatellites are difficult to recover from large plant genomes so cross-specific utilisation is an important source of markers. Fifty micro satellites were tested for cross-specific amplification and polymorphism to two New World hard pine species, slash pine (Pinus elliottii var. elliottii) and Caribbean pine (R caribaea var. hondurensis). Twenty-nine (58%) markers amplified in both hard pine species, and 23 of these 29 were polymorphic. Soft pine (subgenus Strobus) microsatellite markers did amplify, but none were polymorphic. Pinus elliottii var. elliottii and R caribaea var. hondurensis showed mutational changes in the flanking regions and the repeat motif that were informative for Pinus spp. phylogenetic relationships. Most allele length variation could be attributed to variability in repeat unit number. There was no evidence for ascertainment bias.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Molecular breeding is becoming more practical as better technology emerges. The use of molecular markers in plant breeding for indirect selection of important traits can favorably impact breeding efficiency. The purpose of this research is to identify quantitative trait loci (QTL) on molecular linkage groups (MLG) which are associated with seed protein concentration, seed oil concentration, seed size, plant height, lodging, and maturity, in a population from a cross between the soybean cultivars 'Essex' and 'Williams.' DNA was extracted from F-2 generation soybean leaves and amplified via polymerase chain reaction (PCR) using simple sequence repeat (SSR) markers. Markers that were polymorphic between the parents were analyzed against phenotypic trait data from the F-2 and F-4:6 generation. For the F-2 population, significant additive QTL were Satt540 (MLG M, maturity, r(2)=0.11; height, r(2)=0.04, seed size, r(2)=0.061, Satt373 (MLG L, seed size, r(2)=0.04; height, r(2)=0.14), Satt50 (MLG A1, maturity r(2)=0.07), Satt14 (MLG D2, oil, r(2)=0.05), and Satt251 (protein r(2)=0.03, oil, r(2)=0.04). Significant dominant QTL for the F-2 population were Satt540 (MLG M, height, r(2)=0.04; seed size, r(2)=0.06) and Satt14 (MLG D2, oil, r(2)=0.05). In the F-4:6 generation significant additive QTL were Satt239 (MLG I, height, r(2)=0.02 at Knoxville, TN and r(2)=0.03 at Springfield, TN), Satt14 (MLG D2, seed size, r(2)=0.14 at Knoxville, TN), Satt373 (MLG L, protein, r(2)=0.04 at Knoxville, TN) and Satt251 (MLG B I, lodging r(2)=0.04 at Springfield, TN). Averaged over both environments in the F-4:6 generation, significant additive QTL were identified as Satt251 (MLG B 1, protein, r(2)=0.03), and Satt239 (MLG 1, height, r(2)=0.03). The results found in this study indicate that selections based solely on these QTL would produce limited gains (based on low r(2) values). Few QTL were detected to be stable across environments. Further research to identify stable QTL over environments is needed to make marker-assisted approaches more widely adopted by soybean breeders.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Wollemi pine, Wollemia nobilis (Araucariaceae), was discovered in 1994 as the only extant member of the genus, previously known only from the fossil record. With fewer than 100 trees known from an inaccessible canyon in southeastern Australia, it is one of the most endangered tree species in the world. We conducted a comparative population genetic survey at allozyme, amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR) loci in W. nobilis, Araucaria cunninghatnii and Agathis robusta - representatives of the two sister genera. No polymorphism was detected at 13 allozyme loci, more than 800 AFLP loci or the 20 SSR loci screened in W. nobilis. In Ag. robusta only one of 12 allozyme loci, five of 800 AFLP loci and none of the 15 SSR loci were variable. For A. cunninghamii, 10 of > 800 AFLP loci and five of 20 SSR loci were variable. Thus low genetic diversity characterizes all three species. While not ruling out the existence of genetic variation, we conclude that genetic diversity is exceptionally low in the Wollemi pine. To our knowledge this is the most extreme case known in plants. We conclude that the combination of small population effects, clonality and below-average genetic variation in the family are probable contributing factors to the low diversity. The exceptionally low genetic diversity of the Wollemi pine, combined with its known susceptibility to exotic fungal pathogens, reinforces current management policies of strict control of access to the pines and secrecy of the pine locations.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Despite extensive efforts to confirm a direct association between Chlamydia pneumoniae and atherosclerosis, different laboratories continue to report a large variability in detection rates. In this study, we analyzed multiple sections from atherosclerotic carotid arteries from 10 endartectomy patients to determine the location of C. pneumoniae DNA and the number of sections of the plaque required for analysis to obtain a 95% confidence of detecting the bacterium. A sensitive nested PCR assay detected C. pneumoniae DNA in all patients at one or more locations within the plaque. On average, 42% (ranging from 5 to 91%) of the sections from any single patient had C. pneumoniae DNA present. A patchy distribution of C. pneumoniae in the atherosclerotic lesions was observed, with no area of the carotid having significantly more C. pneumoniae DNA present. If a single random 30-mum-thick section was tested, there was only a 35.6 to 41.6% (95% confidence interval) chance of detecting C. pneumoniae DNA in a patient with carotid artery disease. A minimum of 15 sections would therefore be required to obtain a 95% chance of detecting all true positives. The low concentration and patchy distribution of C. pneumoniae DNA in atherosclerotic plaque appear to be among the reasons for inconsistency between laboratories in the results reported.