998 resultados para padronização de variáveis
Resumo:
The objective of this work was to evaluate the effect of diets with different forages (sugarcane, corn silage, hydrolyzed bagasse and sugarcane + corn silage) on the ruminal Fermentation and ruminal nutrients degradability, by the application of bovine somatotropin. Three bovines with ruminal cannulas were used in a factorial scheme (4 x 2). The pH, number of protozoa, ammonia and volatile fatty acids concentration were quantified. The potential and the effective degradability and degradation rate of dry matter and crude protein in each diet were evaluated, beyond gross energy disappearance. There were differences among diets on the effective degradability of dry matter and potential degradability, effective degradability and potentially degradable fraction of crude protein, being verified the same for the rBST application. There was effect of different forages on the variables of ruminal Fermentation. The treatments did not affect the gross energy disappearance. The rBST application did not affect the variables of ruminal fermentation.
Resumo:
A análise fatorial de componentes principais (CP) foi usada no exame do relacionamento entre variáveis de um banco de dados da Empresa Brasileira de Pesquisa Agropecuária (EMBRAPA) Gado de Leite. As variáveis disponíveis foram relacionadas às vacas (dias em lactação, teores lácteos de gordura e extrato seco total, produção de leite, ordem de lactação, peso vivo e grau de sangue), ao manejo (dia de pastejo, disponibilidade e períodos de descanso da pastagem), ao ambiente (estação do ano, precipitação pluviométrica) e ao alimento (consumo de nutrientes do concentrado e da cana × uréia, consumo de MS de pastagem de capim-elefante, composição química e digestibilidade in vitro da pastagem e concentração fecal de PB, FDN e FDA). O primeiro CP (33,7% da inércia dos dados) representou o uso da suplementação volumosa (cana × uréia) da pastagem em resposta à redução sazonal da disponibilidade e do consumo de capim-elefante. O segundo CP (15,3% da inércia) foi relacionado ao consumo de nutrientes do concentrado. O terceiro CP (8,5% da inércia) representou efeitos do manejo sobre a composição química da pastagem. A interpretação gráfica dos resultados favoreceu a percepção mais dinâmica da intensidade da associação e do antagonismo entre as variáveis contextualizadas no estudo.
Resumo:
This dissertation of Mestrado investigated the performance and quality of web sites. The target of the research is the proposal of an integrated model of evaluation of services of digital information in web educational sites. The universe of the research was constituted by eighteen Brazilian Universities that offer after-graduation courses, in the levels of mestrado and doutorado in the area of Engineering of Production. The adopted methodology was a descriptive and exploratory research, using the technique of systematic comment and focus group, for the collection of the data, using itself changeable independent dependents and, through the application of two instruments of research. The analysis protocol was the instrument adopted for evaluation and attainment of qualitative results. E the analysis grating was applied for evaluation and attainment of the quantitative results. The qualitative results had identified to the lack of standardization of web sites, under the attributes of content, hierarchy of information, design of the colors and letters. It of accessibility for carriers of auditory and visual special necessities was observed inexistence, as well as the lack of convergence of medias and assistivas technologies. The language of the sites also was evaluated and all present Portuguese only language. The general result demonstrated in grafico and tables with classification of the Universities, predominating the Good note As for the quantitative results, analysis method ed was estatistico, in order to get the descriptive and inferencial result between the dependent and independent variaveis. How much a category of analysis of the services of the evaluated sites, was found it props up and the index generality weighed. These results had served of base for ranking of existence or inexistence the Universities, how much of the information of services in its web sites. In analysis inferencial the result of the test of correlation or association of the independent variaveis (level, concept of the CAPES and period of existence of the program) with the caracteristicas, called was gotten categories of services. For this analysis the estatisticos methods had been used: coefficient of Spearman and the Test of Fisher. But the category you discipline of the Program of Mestrado presented significance with variavel independent and concept of the CAPES. Main conclusion of this study it was ausencia of satandardization o how much to the subjective aspects, design, hierarchy of information navigability and content precision and the accessibility inexistence and convergence. How much to the quantitative aspects, the information services offered by web sites of the evaluated Universities, still they do not present a satisfactory and including quality. Absence of strategies, adoption of tools web, techniques of institucional marketing and services that become them more interactive, navigable is perceived and with aggregate value
Resumo:
Demand for organic foods within in Brazil are growing, characterizing itself for if constituting in a new strategical segment of commercialization. In this context, the objective of this research was to investigate the variables used by consumers in the purchase decision of organic products, aiming to characterize the level of competitiveness of these products, assisting in the creation of environmental strategies for the development of the activity and contributing in the increment of the knowledge about the subject, that can assist it in the increase of the commercialization and the consumption of these foods. From data collected in the city of Natal/RN, it was used a survey research, of exploratory and descriptive character. The sample was obtained using 401 questionnaires, in which was realized: the Test of Comparison of Averages, Descriptive analysis, analysis of Cluster and Qui-square. The results found in this study indicate that the main reasons for the organic food purchase are the absence of chemical pesticides in the product, followed by the care with own health and of the household. The main characteristics in the consumers of supermarkets, that are associates with purchase frequency of organic foods are the environmental behavior and lifestyle. Among the profile characteristics, gender, age and number of children are associates with the purchase frequency of these foods and the income and level education not showed association
Resumo:
Investigaram-se a temperatura retal, a freqüência respiratória e a taxa de evaporação total de ovinos Corriedale sob três temperaturas ambientes, visando uma melhor compreensão dos mecanismos de termorregulação desses animais. Inicialmente, 21 animais adultos foram alojados em câmara climática à temperatura de 45ºC, e pressão parcial de vapor (PV) variável, registrando-se a freqüência respiratória (FR) e a temperatura retal (TR). Baseando-se na FR e TR, foram selecionados 10 animais, cinco com os valores mais baixos, assumindo-os como mais adaptados ao calor (grupo 1) e cinco com valores mais altos, assumindo-os como menos adaptados (grupo 2). Os animais selecionados foram mantidos em câmara climática, onde mediram-se novamente TR, FR e taxa de evaporacão total (TET), sob 20, 30 e 40ºC de temperatura do ar e PV variável. Não houve diferença estatística entre os grupos classificados, para todas as variáveis medidas. Concluiu-se que a utilização das variáveis fisiológicas TR e FR como parâmetros únicos para a seleção destes animais não é suficiente para avaliar o grau de adaptação a temperaturas elevadas.
Resumo:
Realizou-se este experimento com o objetivo de avaliar a resposta dos porta-enxertos de videira IAC 313 Tropical e IAC 572 Jales a diferentes níveis de alumínio em solução nutritiva. A condução do experimento foi realizada em condições de casa-de-vegetação do Departamento de Produção Vegetal/Área de Horticultura, da Faculdade de Ciências Agronômicas - UNESP/Botucatu. Utilizaram-se cinco níveis de alumínio, a saber: 0, 10, 20, 30 e 40 mg L-1. Após a aplicação dos tratamentos, realizaram-se coletas a cada 15 dias para obtenção das variáveis fisiológicas. O delineamento experimental adotado foi o de parcelas subdivididas, inteiramente casualizado e com 3 repetições. Avaliaram-se as variáveis: taxa de crescimento absoluto e relativo, razão de massa foliar e relação parte aérea/raízes. Concluiu-se que o porta-enxerto IAC 572 Jales, quando submetido ao nível de 10mg Al L-1 na solução, apresentou maior taxa de crescimento absoluto e relativo, e maior redistribuição de massa seca das folhas para o restante da planta, ao passo que o porta-enxerto IAC 313 Tropical, quando submetido a esse nível de alumínio, apresentou um decréscimo acentuado nessas variáveis.
Resumo:
The limits to inform is about the character stico of basic, quimica, mineralogical and mechaniques of matlaughed material used in the manufacturing process the product certified in economic region the Cariri, specifically in the city of Crato, Ceará state, motivated the development of this work, since in this region the exist ing economic context that a general appear as important in the production chains. Were made twentyfive soils-test specimen collection and the study was performed to differentiate the mat laugh materials of variaveis processing of mathing raw materials in the factory The product mica monkeys by extrusion and pressing. The results were obtained ap s as analyzes: grain size, index of plasticity, fluoresce incidence X-ray difration the X-ray, and analyzes thermicals and properties technological. through s of curves gresifica returned to was a comparison between the retro the linear, absorb to water, porosity and bulk density. the results show that the excellent distribution and character acceptable available for the processing of the structure color dark red. needing, therefore, of the mixture of a less plastic clay with thick granulation, that works as plasticity reducer. In spite of the different resignation forms for prensagem and extrusion, the characteristics of absorption of water and rupture tension the flexing was shown inside of the patterns of ABNT
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Conduziu-se este trabalho, com o objetivo de avaliar a qualidade da deposição da calda de pulverização em plantas de feijão (Phaseolus vulgaris L.), Bidens pilosa L. e de Brachiaria plantaginea (Link) Hitchc. presentes na linha e entrelinha da cultura. Foi utilizado como traçador o corante Azul Brilhante FDC-1 (500 ppm). Utilizaram-se cinco pontas de pulverização: jato plano (XR 110015 VS e XR 11002 VS), jato plano duplo (TJ60 11002 VS) e jato cônico (TX-6 VS e TX-8 VS) e dois volumes de aplicação 150 e 200 L ha-1. O delineamento utilizado foi de blocos ao acaso, com 4 repetições. Foram amostradas 25 plantas em cada parcela/repetição, de plantas de feijão e plantas daninhas presentes na linha e na entrelinha da cultura. Após a aplicação, as plantas foram coletadas e lavadas em água destilada para quantificação do traçador em espectrofotômetro. Os dados ajustaram-se à curva de regressão pelo modelo de Gompertz. Os resultados evidenciaram que: para as plantas de feijão as pontas XR 110015 e TJ60 proporcionaram as deposições mais uniformes, nos volumes de 150 e 200 L ha-1, respectivamente; a ponta TX-6 no volume de 150 L ha-1 apresentou melhor uniformidade de distribuição para ambas as espécies de plantas daninhas presentes na linha da cultura; para as plantas daninhas presentes na entrelinha, no volume de 150 L ha-1, destacaram-se as pontas XR 110015 e TJ60 11002 para B. pilosa e B. plantaginea, respectivamente, no volume de 200 L ha-1 destacou-se a ponta TX-8 para ambas as espécies.
Resumo:
Among the main challenges in the beer industrial production is the market supply at the lowest cost and high quality, in order to ensure the expectations of customers and. consumers The beer fermentation stage represents approximately 70% of the whole time necessary to its production, having a obligatoriness of strict process controls to avoid becoming bottleneck in beer production. This stage is responsible for the formation of a series of subproducts, which are responsible for the composition of aroma/bouquet existing in beer and some of these subproducts, if produced in larger quantities, they will confer unpleasant taste and odor to the final product. Among the subproducts formed during the fermentation stage, total vicinal diketones is the main component, since it is limiting for product transfusion to the subsequent steps, besides having a low perception threshold by the consumer and giving undesirable taste and odor. Due to the instability of main raw materials quality and also process controls during fermentation, the development of alternative forms of beer production without impacting on total fermentation time and final product quality is a great challenge to breweries. In this work, a prior acidification of the pasty yeast was carried out, utilizing for that phosphoric acid, food grade, reducing yeast pH of about 5.30 to 2.20 and altering its characteristic from flocculent to pulverulent during beer fermentation. An increase of six times was observed in amount of yeast cells in suspension in the second fermentation stage regarding to fermentations by yeast with no prior acidification. With alteration on two input variables, temperature curve and cell multiplication, which goal was to minimize the maximum values for diketones detected in the fermenter tank, a reduction was obtained from peak of formed diacetyl and consequently contributed to reduction in fermentation time and total process time. Several experiments were performed with those process changes in order to verify the influence on the total fermentation time and total vicinal diketones concentration at the end of fermentation. This experiment reached as the best production result a total fermentation time of 151 hours and total vicinal diketone concentration of 0.08 ppm. The mass of yeast in suspension in the second phase of fermentation increased from 2.45 x 106 to 16.38 x 106 cells/mL of yeast, which fact is key to a greater efficiency in reducing total vicinal diketones existing in the medium, confirming that the prior yeast acidification, as well as the control of temperature and yeast cell multiplication in fermentative process enhances the performance of diketones reduction and consequently reduce the total fermentation time with diketones concentration below the expected value (Max: 0.10 ppm)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
The interest in the systematic analysis of astronomical time series data, as well as development in astronomical instrumentation and automation over the past two decades has given rise to several questions of how to analyze and synthesize the growing amount of data. These data have led to many discoveries in the areas of modern astronomy asteroseismology, exoplanets and stellar evolution. However, treatment methods and data analysis have failed to follow the development of the instruments themselves, although much effort has been done. In present thesis, we propose new methods of data analysis and two catalogs of the variable stars that allowed the study of rotational modulation and stellar variability. Were analyzed the photometric databases fromtwo distinctmissions: CoRoT (Convection Rotation and planetary Transits) and WFCAM (Wide Field Camera). Furthermore the present work describes several methods for the analysis of photometric data besides propose and refine selection techniques of data using indices of variability. Preliminary results show that variability indices have an efficiency greater than the indices most often used in the literature. An efficient selection of variable stars is essential to improve the efficiency of all subsequent steps. Fromthese analyses were obtained two catalogs; first, fromtheWFCAMdatabase we achieve a catalog with 319 variable stars observed in the photometric bands Y ZJHK. These stars show periods ranging between ∼ 0, 2 to ∼ 560 days whose the variability signatures present RR-Lyrae, Cepheids , LPVs, cataclysmic variables, among many others. Second, from the CoRoT database we selected 4, 206 stars with typical signatures of rotationalmodulation, using a supervised process. These stars show periods ranging between ∼ 0, 33 to ∼ 92 days, amplitude variability between ∼ 0, 001 to ∼ 0, 5 mag, color index (J - H) between ∼ 0, 0 to ∼ 1, 4 mag and spectral type CoRoT FGKM. The WFCAM variable stars catalog is being used to compose a database of light curves to be used as template in an automatic classifier for variable stars observed by the project VVV (Visible and Infrared Survey Telescope for Astronomy) moreover it are a fundamental start point to study different scientific cases. For example, a set of 12 young stars who are in a star formation region and the study of RR Lyrae-whose properties are not well established in the infrared. Based on CoRoT results we were able to show, for the first time, the rotational modulation evolution for an wide homogeneous sample of field stars. The results are inagreement with those expected by the stellar evolution theory. Furthermore, we identified 4 solar-type stars ( with color indices, spectral type, luminosity class and rotation period close to the Sun) besides 400 M-giant stars that we have a special interest to forthcoming studies. From the solar-type stars we can describe the future and past of the Sun while properties of M-stars are not well known. Our results allow concluded that there is a high dependence of the color-period diagram with the reddening in which increase the uncertainties of the age-period realized by previous works using CoRoT data. This thesis provides a large data-set for different scientific works, such as; magnetic activity, cataclysmic variables, brown dwarfs, RR-Lyrae, solar analogous, giant stars, among others. For instance, these data will allow us to study the relationship of magnetic activitywith stellar evolution. Besides these aspects, this thesis presents an improved classification for a significant number of stars in the CoRoT database and introduces a new set of tools that can be used to improve the entire process of the photometric databases analysis
Resumo:
Morbidly obese patients present an increase in heart rate, blood pressure and perceived exertion besides lower walking ability compared to normal weight people. However, little is known about how these variables are presented after bariatric surgery. Moreover, despite the distance walked during the six-minute walk (6MWT) improve after surgery is not well established if the level of physical activity influences this improvement. Objective: To evaluate cardiovascular performance, perceived effort, ability of walking and physical activity level of patients with morbid obesity before and after bariatric surgery. Methods: The cardiovascular performance, perception of effort, the ability to walk and level of physical activity were assessed in 22 patients before (BMI = 50.4 kg/m2) and after (BMI = 34.8 kg/m2) bariatric surgery through the 6MWT. The heart rate, blood pressure and perceived exertion were assessed at rest, at the end of the 6MWT and in the second minute post-test (HR recovery). The ability to walk was measured by total distance walked at the end of the test while the level of physical activity was estimated by applying the Baecke questionnaire, analyzing domains occupation, leisure and locomotion and leisure and physical activity. Results: The HR at rest and recovery decreased significantly (91.2 ± 15.8 bpm vs. 71.9 ± 9.8 bpm, 99.5 ± 15.3 bpm vs 82.5 ± 11.1 bpm, respectively), as well as all the arterial pressure and perceived exertion after surgery. The distance achieved by the patients increased by 58.4 m (p = 0.001) postoperatively. Time postoperatively had correlation with the percentage of excess weight lost (r = 0.48, p = 0.02), BMI (r =- 0.68, p = 0.001) and the Baecke (r = 0.52, p = 0.01) which did not happen with the distance walked (r = 0.37, p = 0.09). Despite weight loss, patients showed no difference in the level of physical activity in any of the areas before and after surgery. Conclusion: The cardiovascular performance, the perception of effort and ability to walk seem to improve after bariatric surgery. However, despite improvement in the ability to walk by the distance achieved in the 6MWT after weight loss, this is not reflected in an increase in physical activity level of obese patients after surgery
Resumo:
Introduction: Falls among older adults is a public health problem, therefore it is necessary preventive actions, however the adherence is the major problem faced by practitioners and researchers working on falls prevention programs. Objective: To evaluate the variables related to the adherence to falls prevention programs among the elderly enrolled in a Basic Health Unit (BHU). Methods: Was performed an observational cross-sectional analytical study. All elderly registered in a BHU and able to ambulate independently were invited to participate in a falls prevent program. The Elderly who Adhered to the Program (EAP) were evaluated at BHU; and the Elderly Not Adhered to the Program (ENAP) were identified and assessed at home. The assessment for both groups was performed using an evaluation form containing personal data, measures and clinical scales to assess cognitive status, balance, mobility, fear of falling, handgrip strength. Data were analyzed with SPSS 20.0. In addition to this assessment, the ENAP underwent a semi structured interview, in which we used the qualitative approach based on the figure of the Collective Subject Discourse. Results: The study included 222 elderly, 111 EAP and 111ENAP, most aged between 70 and 79 years (48.2%), female (68.5%), married (52.3%) and illiterate (47.7%). Consolidated as protective factors for adherence, worst rates of physical activity (p = 0.001), balance (p = 0.010) and cognition (p = 0.007). The interview of ENAP identified two themes: "Local implementation of programs for the prevention of falls" and "Relationship between BHU and the elderly health care," and found that the elderly who did not adhere were unable to displace and did not mention that primary care programs are related to health care in elderly. Conclusions: Elderly who do not adhere to the program differ from elderly who adhere as worst indices of cognition, balance and physical activity which implies greater risk of falling; and they were unable to participate in falls prevention program and by to be caregiver and showed displacement difficult
Resumo:
A obesidade é uma epidemia global em alarmante ascensão. Caracterizada pelo excesso de gordura corporal subcutânea, de caráter multifatorial, está relacionada ao surgimento de diversas co-morbidades, entre elas, várias alterações respiratórias, estas se tornam mais intensas quanto maior o grau de obesidade. Não há consenso na relação entre os marcadores de adiposidade geral ou específicos e suas repercussões sobre a função ventilatória, especialmente em relação à sobrecarga muscular respiratória. Objetivo: Analisar a relação entre marcadores antropométricos e variáveis espirométricas e de força muscular respiratória em indivíduos com obesidade mórbida. Métodos: Estudo transversal entre setembro de 2007 e outubro de 2012. Participaram da pesquisa 163 obesos mórbidos (37.1±9.8 anos e IMC=49.0±5.88 Kg/m2) sem alterações espirométricas. Foram observadas as associações entre Índice de Massa Corporal-IMC, adiposidade localizada (Circunferências de Pescoço-CP, Cintura-CC e Quadril-CQ), percentual de gordura corporal através do Índice de Adiposidade Corporal-IAC, volumes e capacidades pulmonares (CVF, VEF1 e VRE) e pressões respiratória estática (PIM e PEM) e dinâmica (VVM). Resultados: O VRE foi o volume mais afetado pela obesidade (apenas 41%predito) e mostrou associação negativa nas relações com todos os marcadores de adiposidade (IMC: r=-0.52; IAC: r=-0.21; CC: r=-0.44; CP: r=-0.25 e CQ: r=-0.28). Há relação inversa entre o percentual de gordura corporal (IAC) com a CVF (r=-0.59), o VEF1(r=-0.56) e o VVM (r=-0.43). As pressões respiratórias são justificadas principalmente pela adiposidade ao redor do pescoço e o IAC. Nossos dados de força muscular respiratória foram melhores associados aos valores de referências sugeridos pelas equações de Harik-Klan et al (1998) para PIM (R²=0.72) e com a equação proposta por Neder et al (1999) para PEM (R²=0.52). Em um modelo de regressão linear, as variáveis de adiposidade não justificam a VVM, já o VEF1 explica 62% da variância da VVM em obesos mórbidos. Conclusão: O percentual da adiposidade corporal e a circunferência do pescoço estão associados com a força muscular e capacidade de gerar fluxo respiratório de obesos mórbidos. Sugerimos a equação elaborada por Harik-Klan et al (1998) para obtenção de valores preditos de PIM e a equação proposta por Neder et al (1999) para valores de normalidade da PEM em sujeitos com obesidade mórbida. Foi possível fornecer uma equação de referência específica para VVM em obesos mórbidos