688 resultados para Zhongguo gong chan dang


Relevância:

10.00% 10.00%

Publicador:

Resumo:

NLRC5 is a transcriptional regulator of MHC class I (MHCI), which maintains high MHCI expression particularly in T cells. Recent evidence highlights an important NK-T-cell crosstalk, raising the question on whether NLRC5 specifically modulates this interaction. Here we show that NK cells from Nlrc5-deficient mice exhibit moderate alterations in inhibitory receptor expression and responsiveness. Interestingly, NLRC5 expression in T cells is required to protect them from NK-cell-mediated elimination upon inflammation. Using T-cell-specific Nlrc5-deficient mice, we show that NK cells surprisingly break tolerance even towards 'self' Nlrc5-deficient T cells under inflammatory conditions. Furthermore, during chronic LCMV infection, the total CD8(+) T-cell population is severely decreased in these mice, a phenotype reverted by NK-cell depletion. These findings strongly suggest that endogenous T cells with low MHCI expression become NK-cell targets, having thus important implications for T-cell responses in naturally or therapeutically induced inflammatory conditions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Deep sternal wound infection (DSWI) is a feared complication following cardiac surgery. This study describes clinical, microbiological, and treatment outcomes of DSWI and determines risk factors for complications. Of 55 patients with DSWI, 66% were male and mean age was 68.2years. Initial sternotomy was for coronary artery bypass graft in 49% of patients. Sternal debridement at mean 25.4±18.3days showed monomicrobial (94%), mainly Gram-positive infection. Secondary sternal wound infection (SSWI) occurred in 31% of patients, was mostly polymicrobial (71%), and was predominantly due to Gram-negative bacilli. Risk factors for SSWI were at least 1 revision surgery (odds ratio [OR] 4.8 [95% confidence interval {CI} 1.0-22.4], P=0.047), sternal closure by muscle flap (OR 4.6 [1.3-16.8], P=0.02), delayed sternal closure (mean 27 versus 14days, P=0.03), and use of vacuum-assisted closure device (100% versus 58%, P=0.008). Hospital stay was significantly longer in patients with SSWI (69days versus 48days, P=0.04).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Abstract Objective: To estimate the entrance surface air kerma (Ka,e) and air kerma in the region of radiosensitive organs in radiographs of pediatric paranasal sinuses. Materials and Methods: Patient data and irradiation parameters were collected in examinations of the paranasal sinuses in children from 0 to 15 years of age at two children's hospitals in the city of Recife, PE, Brazil. We estimated the Ka,e using the X-ray tube outputs and selected parameters. To estimate the air kerma values in the regions of the eyes and thyroid, we used thermoluminescent dosimeters. Results: The Ka,e values ranged from 0.065 to 1.446 mGy in cavum radiographs, from 0.104 to 7.298 mGy in Caldwell views, and from 0.113 to 7.824 mGy in Waters views. Air kerma values in the region of the eyes ranged from 0.001 to 0.968 mGy in cavum radiographs and from 0.011 to 0.422 mGy in Caldwell and Waters views . In the thyroid region, air kerma values ranged from 0.005 to 0.932 mGy in cavum radiographs and from 0.002 to 0.972 mGy in Caldwell and Waters views. Conclusion: The radiation levels used at the institutions under study were higher than those recommended in international protocols. We recommend that interventions be initiated in order to reduce patient exposure to radiation and therefore the risks associated with radiological examination of the paranasal sinuses.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neste artigo, interrogamos os funcionamentos do conceito de platô em "Mil Platôs" (1980), a obra-prima de Deleuze e Guattari. Essa pesquisa esclarece, de forma concreta, duas linhas de pensamento, que são a epistemológica, por um lado, e a ética, por outro, enfocando os parágrafos nos quais Deleuze e Guattari usam efetivamente esse conceito. Do ponto de vista epistemológico, o conceito de platô permite praticar uma maneira de escrita rizomática e a explicação antiteleológica. Do ponto de vista ético, esse conceito, tirado de Gregory Bateson, nos convida a formar a alegria contínua e global, ou a gaieté em termos espinosistas.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Both genetic background and diet have profound effects on plasma lipid profiles. We hypothesized that a high-carbohydrate (high-CHO) diet may affect the ratios of serum lipids and apolipoproteins (apo) differently in subjects with different genotypes of the SstI polymorphism in the apoCIII gene (APOC3). Fifty-six healthy university students (27 males and 29 females, 22.89 ± 1.80 years) were given a washout diet of 54% carbohydrate for 7 days, followed by a high-CHO diet of 70% carbohydrate for 6 days without total energy restriction. Serum triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), apoB100, apoAI, and the APOC3 SstI polymorphism were analyzed. The ratios of serum lipids and apoB100/apoAI were calculated. At baseline, the TG/HDL-C ratio was significantly higher in females, but not in males, with the S2 allele. The differences in the TG/HDL-C ratio between genotypes remained the same after the washout and the high-CHO diet in females. When compared with those before the high-CHO diet, the TC/HDL-C (male S2 carriers: 3.13 ± 1.00 vs 2.36 ± 0.65, P = 0.000; male subjects with the S1S1 genotype: 2.97 ± 0.74 vs 2.09 ± 0.55, P = 0.000; female S2 carriers: 2.68 ± 0.36 vs 2.24 ± 0.37, P = 0.004; female subjects with the S1S1 genotype: 2.69 ± 0.41 vs 2.09 ± 0.31, P = 0.000) and LDL-C/HDL-C (male S2 carriers: 1.44 ± 0.71 vs 1.06 ± 0.26, P = 0.012; male subjects with the S1S1 genotype: 1.35 ± 0.61 vs 1.01 ± 0.29, P = 0.005; female S2 carriers: 1.18 ± 0.33 vs 1.00 ± 0.18, P = 0.049; female subjects with the S1S1 genotype: 1.18 ± 0.35 vs 1.04 ± 0.19, P = 0.026) ratios were significantly decreased after the high-CHO diet regardless of gender and of genotype of the APOC3 SstI polymorphism. However, in female S2 carriers, the TG/HDL-C (1.38 ± 0.46 vs 1.63 ± 0.70, P = 0.039) ratio was significantly increased after the high-CHO diet. In conclusion, the high-CHO diet has favorable effects on the TC/HDL-C and LDL-C/HDL-C ratios regardless of gender and of genotype of the APOC3 SstI polymorphism. Somehow, it enhanced the adverse effect of the S2 allele on the TG/HDL-C ratio only in females.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Major histocompatibility complex class I chain-related A (MICA) is a highly polymorphic gene located within the MHC class I region of the human genome. Expressed as a cell surface glycoprotein, MICA modulates immune surveillance by binding to its cognate receptor on natural killer cells, NKG2D, and its genetic polymorphisms have been recently associated with susceptibility to some infectious diseases. We determined whether MICA polymorphisms were associated with the high rate of Schistosoma parasitic worm infection or severity of disease outcome in the Dongting Lake region of Hunan Province, China. Polymerase chain reaction-sequence specific priming (PCR-SSP) and sequencing-based typing (SBT) were applied for high-resolution allele typing of schistosomiasis cases (N = 103, age range = 36.2-80.5 years, 64 males and 39 females) and healthy controls (N = 141, age range = 28.6-73.3 years, 73 males and 68 females). Fourteen MICA alleles and five short-tandem repeat (STR) alleles were identified among the two populations. Three (MICA*012:01/02, MICA*017 and MICA*027) showed a higher frequency in healthy controls than in schistosomiasis patients, but the difference was not significantly correlated with susceptibility to S. japonicum infection (Pc > 0.05). In contrast, higher MICA*A5 allele frequency was significantly correlated with advanced liver fibrosis (Pc < 0.05). Furthermore, the distribution profile of MICA alleles in this Hunan Han population was significantly different from those published for Korean, Thai, American-Caucasian, and Afro-American populations (P < 0.01), but similar to other Han populations within China (P > 0.05). This study provides the initial evidence that MICA genetic polymorphisms may underlie the severity of liver fibrosis occurring in schistosomiasis patients from the Dongting Lake region.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study explored the reduction of adenosine triphosphate (ATP) levels in L-02 hepatocytes by hexavalent chromium (Cr(VI)) using chi-square analysis. Cells were treated with 2, 4, 8, 16, or 32 μM Cr(VI) for 12, 24, or 36 h. Methyl thiazolyl tetrazolium (MTT) experiments and measurements of intracellular ATP levels were performed by spectrophotometry or bioluminescence assays following Cr(VI) treatment. The chi-square test was used to determine the difference between cell survival rate and ATP levels. For the chi-square analysis, the results of the MTT or ATP experiments were transformed into a relative ratio with respect to the control (%). The relative ATP levels increased at 12 h, decreased at 24 h, and increased slightly again at 36 h following 4, 8, 16, 32 μM Cr(VI) treatment, corresponding to a "V-shaped" curve. Furthermore, the results of the chi-square analysis demonstrated a significant difference of the ATP level in the 32-μM Cr(VI) group (P < 0.05). The results suggest that the chi-square test can be applied to analyze the interference effects of Cr(VI) on ATP levels in L-02 hepatocytes. The decreased ATP levels at 24 h indicated disruption of mitochondrial energy metabolism and the slight increase of ATP levels at 36 h indicated partial recovery of mitochondrial function or activated glycolysis in L-02 hepatocytes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We developed a forced non-electric-shock running wheel (FNESRW) system that provides rats with high-intensity exercise training using automatic exercise training patterns that are controlled by a microcontroller. The proposed system successfully makes a breakthrough in the traditional motorized running wheel to allow rats to perform high-intensity training and to enable comparisons with the treadmill at the same exercise intensity without any electric shock. A polyvinyl chloride runway with a rough rubber surface was coated on the periphery of the wheel so as to permit automatic acceleration training, and which allowed the rats to run consistently at high speeds (30 m/min for 1 h). An animal ischemic stroke model was used to validate the proposed system. FNESRW, treadmill, control, and sham groups were studied. The FNESRW and treadmill groups underwent 3 weeks of endurance running training. After 3 weeks, the experiments of middle cerebral artery occlusion, the modified neurological severity score (mNSS), an inclined plane test, and triphenyltetrazolium chloride were performed to evaluate the effectiveness of the proposed platform. The proposed platform showed that enhancement of motor function, mNSS, and infarct volumes was significantly stronger in the FNESRW group than the control group (P<0.05) and similar to the treadmill group. The experimental data demonstrated that the proposed platform can be applied to test the benefit of exercise-preconditioning-induced neuroprotection using the animal stroke model. Additional advantages of the FNESRW system include stand-alone capability, independence of subjective human adjustment, and ease of use.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

High levels of low-density lipoprotein cholesterol (LDL-C) enhance platelet activation, whereas high levels of high-density lipoprotein cholesterol (HDL-C) exert a cardioprotective effect. However, the effects on platelet activation of high levels of LDL-C combined with low levels of HDL-C (HLC) have not yet been reported. We aimed to evaluate the platelet activation marker of HLC patients and investigate the antiplatelet effect of atorvastatin on this population. Forty-eight patients with high levels of LDL-C were enrolled. Among these, 23 had HLC and the other 25 had high levels of LDL-C combined with normal levels of HDL-C (HNC). A total of 35 normocholesterolemic (NOMC) volunteers were included as controls. Whole blood flow cytometry and platelet aggregation measurements were performed on all participants to detect the following platelet activation markers: CD62p (P-selectin), PAC-1 (GPIIb/IIIa), and maximal platelet aggregation (MPAG). A daily dose of 20 mg atorvastatin was administered to patients with high levels of LDL-C, and the above assessments were obtained at baseline and after 1 and 2 months of treatment. The expression of platelets CD62p and PAC-1 was increased in HNC patients compared to NOMC volunteers (P<0.01 and P<0.05). Furthermore, the surface expression of platelets CD62p and PAC-1 was greater among HLC patients than among HNC patients (P<0.01 and P<0.05). Although the expression of CD62p and PAC-1 decreased significantly after atorvastatin treatment, it remained higher in the HLC group than in the HNC group (P<0.05 and P=0.116). The reduction of HDL-C further increased platelet activation in patients with high levels of LDL-C. Platelet activation remained higher among HLC patients regardless of atorvastatin treatment.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We investigated the biological significance of microRNA-126 (miR-126) expression in patients with atrial fibrillation (AF) and/or heart failure (HF) to examine the possible mechanism of miR-126-dependent AF and development of HF. A total of 103 patients were divided into three groups: AF group (18 men and 17 women, mean age: 65.62±12.72 years), HF group (17 men and 15 women, mean age: 63.95±19.71 years), and HF-AF group (20 men and 16 women, mean age: 66.56±14.37 years). Quantitative real-time PCR was used to measure relative miR-126 expression as calculated by the 2−ΔΔCt method. miR-126 was frequently downregulated in the 3 patient groups compared with controls. This reduction was significantly lower in permanent and persistent AF patients than in those with paroxysmal AF (P<0.05, t-test). Moreover, miR-126 expression was markedly lower in the HF-AF group compared with the AF and HF groups. The 3 patient groups had higher N-terminal prohormone brain natriuretic peptide (NT-proBNP) levels, lower left ventricular ejection fraction (LVEF), larger left atrial diameter, and higher cardiothoracic ratio compared with controls. There were significant differences in NT-proBNP levels and LVEF among the AF, HF, and HF-AF groups. Pearson correlation analysis showed that relative miR-126 expression was positively associated with LVEF, logarithm of NT-proBNP, left atrial diameter, cardiothoracic ratio, and age in HF-AF patients. Multiple linear regression analysis showed that miR-126 expression was positively correlated with LVEF, but negatively correlated with the logarithm of NT-pro BNP and the cardiothoracic ratio (all P<0.05). Serum miR-126 levels could serve as a potential candidate biomarker for evaluating the severity of AF and HF. However, to confirm these results, future studies with a larger and diverse patient population are necessary.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Contient : Notes sur l'abbaye de Fontaines les Blanches. Au feuillet 15 r° dessin à l'encre des armoiries de ladite abbaye ; Notes sur l'abbaye de La Guiche ; Notes sur l'abbaye de Lepvroux ; Note sur l'abbaye du Landais ; Notes sur Moulin, sous Lepvroux ; Note sur Buzançois ; Notes sur l'abbaye de Marmoutiers ; Notes sur l'abbaye de Pontlevoy. Au feuillet 127, « cachet de Pontlevoy ». Au feuillet 130 r°, dessin à l'encre des armes de Pontlevoy. Le feuillet 131 est occupé par une lettre autographe signée : « GIRARDEAU », datée de Pontlevoy, 14 mars 1678, et adressée à l'abbé Bégon. Les feuillets 132-133 sont occupés par une lettre autographe signée : « Fr. MARTIN FILANE, m. b. », datée de Pontlevoy, 7 mai 1678, et adressée à M. l'abbé Bégon. Au fol. 138-139, lettre incomplète datée de Monteaux, 1er juillet 1678. Au fol. 144-145, lettre autographe signée : « P. GIRARDEAU » et datée de Blois, 29 avril 1678, à l'abbé Bégon ; Notes sur l'abbaye de S. Calais ; Notes sur l'abbaye de S. Laumer. Au feuillet 203, dessin à l'encre intitulé : « Main de justice, non sine causa ». Aux feuillets 208, 208 bis et 209, dessins à l'encre représentant les armoiries de l'abbaye de S. Lomer et des « tombeaux de l'eglise de S. Laumer de Blois », savoir : « armes de M. l'abbé de Morvilliers » ; armes de « Guy Pot, chambellan de Charles VIII » ; « armes de Mr de La Vieuville, evesque de Rennes et abbé de S. Lomer ; armes de « monseigneur le cardinal de Sourdy, archevesque de Bourdeaux, abbé de S. Lomer » ; « armes de Mr Fouquet de La Varenne, abbé de S. Lomer, qui fit retablir et recouvrir l'eglise de S. Laumer, l'an 1610 » ; Lettre autographe, signée : « B. CAMUSAT » et datée de Paris, 8 janvier 1681. A l'abbé Bégon ; Armes de la ville de Vendôme, dessinées à l'encre ; Note sur S. Dyé, envoyée à l'abbé Bégon, avec, à la fin, quelques lignes autographes, signées : « POIRIER, presbtre, curé de St Dyé », et datées de S. Dyé, le 7 juillet 1679 ; Lettre autographe signée : « GAIGNAISON, curé de Thenay », et datée de Thenay le 25 août 1678. A l'abbé Bégon ; Note sur la paroisse de Centenay, écrite par le « prieur curé de Centenay », qui signe : « HONYER » ; Note sur la « paroisse de Fleuré », par le curé de Fleuré ; Note sur S. Claude de Diray, écrite par le curé dudit lieu qui signe : « VACHER, curé de S. Claude de Diray », 3 juillet 1682. A l'abbé Bégon ; Lettre autographe signée : « GRYMAULDI,... à monsieur, monsieur Begon, conseiller et secretaire du roy, maison et couronne de France, à Paris... A Blois, ce IX apvril 1653 » ; Lettre autographe datée : « Au Mans, le 28 aoust 1680, et signée : « ETTE. chan. ind. de St Pierre ». A l'abbé Begon ; Note sur la paroisse de Monts, envoyée à l'abbé Bégon par le curé de cette paroisse, dans une lettre dont la signature est mutilée ; Note sur la paroisse de Chambon par le curé de Chambon, qui a signé : « BLE » ; Lettre autographe de l'abbé Bégon à son père. Elle est datée de Paris, 28 juin 1662. La signature, si toutefois ladite lettre était signée, a été enlevée par une mutilation du feuillet 398

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Développement par Han Lin, surnom Yu gong, de six maximes recommandées par l'empereur Tai zu des Ming (1397) ; ouvrage non daté. Préfaces de Han Lin, de Li Zheng xiu.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Par le même. Revu par Bi Gong chen, de Dong lai ; gravé de nouveau par les soins de Yang Wen zhang, de Jiang. Préface de Liang Yun gou, surnom Jiang xian, de Zhong zhou (1636) ; postface de Bi Gong chen (1635).2 livres (le 2e est en tête du volume).