Effect of high hydrostatic pressure on the barrier properties of polyamide-6 films

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Beneficial effect of recombinant human growth hormone on the intestinal mucosa barrier of septic rats

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Synaptic vesicle pool size, release probability and synaptic depression are sensitive to Ca2+ buffering capacity in the developing rat calyx of Held

The calyx of Held, a specialized synaptic terminal in the medial nucleus of the trapezoid body, undergoes a series of changes during postnatal development that prepares this synapse for reliable high frequency firing. These changes reduce short-term synaptic depression during tetanic stimulation and thereby prevent action potential failures during a stimulus train. We measured presynaptic membrane capacitance changes in calyces from young postnatal day 5-7 (p5-7) or older (p10-12) rat pups to examine the effect of calcium buffer capacity on vesicle pool size and the efficiency of exocytosis. Vesicle pool size was sensitive to the choice and concentration of exogenous Ca2+ buffer, and this sensitivity was much stronger in younger animals. Pool size and exocytosis efficiency in p5-7 calyces were depressed by 0.2 mM EGTA to a greater extent than with 0.05 mM BAPTA, even though BAPTA is a 100-fold faster Ca2+ buffer. However, this was not the case for p10-12 calyces. With 5 mM EGTA, exocytosis efficiency was reduced to a much larger extent in young calyces compared to older calyces. Depression of exocytosis using pairs of 10-ms depolarizations was reduced by 0.2 mM EGTA compared to 0.05 mM BAPTA to a similar extent in both age groups. These results indicate a developmentally regulated heterogeneity in the sensitivity of different vesicle pools to Ca2+ buffer capacity. We propose that, during development, a population of vesicles that are tightly coupled to Ca2+ channels expands at the expense of vesicles more distant from Ca2+ channels.

Trailing end-point phenotype antibiotic-sensitive strains of Candida albicans produce different amounts of aspartyl peptidases

Candida albicans is an opportunistic fungal pathogen that causes severe systemic infections in immunosuppressed individuals. C. albicans resistance to antifungal drugs is a severe problem in patients receiving prolonged therapy. Moreover, trailing yeast growth, which is defined as a resistant MIC after 48 h of incubation with triazole antifungal agents but a susceptible MIC after 24 h, has been noted in tests of antifungal susceptibility against some C. albicans isolates. In this context, we recently noticed this phenomenon in our routine susceptibility tests with fluconazole/itraconazole and C. albicans clinical isolates. In the present study, we investigated the production of cell-associated and secreted aspartyl peptidases (Saps) in six trailing clinical isolates of C. albicans, since this class of hydrolytic enzymes is a well-known virulence factor expressed by this fungal pathogen. Sap2, which is the best-studied member of the Sap family, was detected by flow cytometry on the cell surface of yeasts and as a 43-kDa polypeptide in the culture supernatant, as demonstrated by Western blotting assay using an anti-Sap1-3 polyclonal antibody. Released aspartyl peptidase activity was measured with BSA hydrolysis and inhibited by pepstatin A, showing distinct amounts of proteolytic activity ranging from 5.7 (strain 44B) to 133.2 (strain 11) arbitrary units. Taken together, our results showed that trailing clinical isolates of C. albicans produced different amounts of both cellular and secreted aspartyl-type peptidases, suggesting that this phenotypic feature did not generate a regular pattern regarding the expression of Sap.

Phenylpyrazolone derivatives inhibit gastric emptying in rats by a capsaicin-sensitive afferent pathway

Dipyrone (Dp), 4-aminoantipyrine (AA) and antipyrine (At) administered iv and Dp administered icv delay gastric emptying (GE) in rats. The participation of capsaicin (Cps)-sensitive afferent fibers in this phenomenon was evaluated. Male Wistar rats were pretreated sc with Cps (50 mg/kg) or vehicle between the first and second day of life and both groups were submitted to the eye-wiping test. GE was determined in these animals at the age of 8/9 weeks (weight: 200-300 g). Ten minutes before the study, the animals of both groups were treated iv with Dp, AA or At (240 μmol/kg), or saline; or treated icv with Dp (4 μmol/animal) or saline. GE was determined 10 min after treatment by measuring % gastric retention (GR) of saline labeled with phenol red 10 min after orogastric administration. Percent GR (mean ± SEM, N = 8) in animals pretreated with Cps and treated with Dp, AA or At (35.8 ± 3.2, 35.4 ± 2.2, and 35.6 ± 2%, respectively) did not differ from the GR of saline-treated animals pretreated with vehicle (36.8 ± 2.8%) and was significantly lower than in animals pretreated with vehicle and treated with the drugs (52.1 ± 2.8, 66.2 ± 4, and 55.8 ± 3%, respectively). The effect of icv administration of Dp (N = 6) was not modified by pretreatment with Cps (63.3 ± 5.7%) compared to Dp-treated animals pretreated with vehicle (62.3 ± 2.4%). The results suggest the participation of capsaicin-sensitive afferent fibers in the delayed GE induced by iv administration of Dp, AA and At, but not of icv Dp.

Highly sensitive C-reactive protein and male gender are independently related to the severity of coronary disease in patients with metabolic syndrome and an acute coronary event

Patients with metabolic syndrome are at high-risk for development of atherosclerosis and cardiovascular events. The objective of this study was to examine the major determinants of coronary disease severity, including those coronary risk factors associated with metabolic syndrome, during the early period after an acute coronary episode. We tested the hypothesis that inflammatory markers, especially highly sensitive C-reactive protein (hsCRP), are related to coronary atherosclerosis, in addition to traditional coronary risk factors. Subjects of both genders aged 30 to 75 years (N = 116) were prospectively included if they had suffered a recent acute coronary syndrome (acute myocardial infarction or unstable angina pectoris requiring hospitalization) and if they had metabolic syndrome diagnosed according to the National Cholesterol Education Program/Adult Treatment Panel III. Patients were submitted to a coronary angiography and the burden of atherosclerosis was estimated by the Gensini score. The severity of coronary disease was correlated (Spearman’s or Pearson’s coefficient) with gender (r = 0.291, P = 0.008), age (r = 0.218, P = 0.048), hsCRP (r = 0.256, P = 0.020), ApoB/ApoA ratio (r = 0.233, P = 0.041), and carotid intima-media thickness (r = 0.236, P = 0.041). After multiple linear regression, only male gender (P = 0.046) and hsCRP (P = 0.012) remained independently associated with the Gensini score. In this high-risk population, male gender and high levels of hsCRP, two variables that can be easily obtained, were associated with more extensive coronary disease, identifying patients with the highest potential of developing new coronary events.

Tumor necrosis factor alpha increases epithelial barrier permeability by disrupting tight junctions in Caco-2 cells

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Inactivation of capsaicin-sensitive nerves reduces pulmonary remodeling in guinea pigs with chronic allergic pulmonary inflammation

Pulmonary remodeling is an important feature of asthma physiopathology that can contribute to irreversible changes in lung function. Although neurokinins influence lung inflammation, their exact role in the extracellular matrix (ECM) remodeling remains to be determined. Our objective was to investigate whether inactivation of capsaicin-sensitive nerves modulates pulmonary ECM remodeling in animals with chronic lung inflammation. After 14 days of capsaicin (50 mg/kg, sc) or vehicle administration, male Hartley guinea pigs weighing 250-300 g were submitted to seven inhalations of increasing doses of ovalbumin (1, 2.5, and 5 mg/mL) or saline for 4 weeks. Seventy-two hours after the seventh inhalation, animals were anesthetized and mechanically ventilated and the lung mechanics and collagen and elastic fiber content in the airways, vessels and lung parenchyma were evaluated. Ovalbumin-exposed animals presented increasing collagen and elastic fiber content, respectively, in the airways (9.2 ± 0.9; 13.8 ± 1.2), vessels (19.8 ± 0.8; 13.4 ± 0.5) and lung parenchyma (9.2 ± 0.9; 13.8 ± 1.2) compared to control (P < 0.05). Capsaicin treatment reduced collagen and elastic fibers, respectively, in airways (1.7 ± 1.1; 7.9 ± 1.5), vessels (2.8 ± 1.1; 4.4 ± 1.1) and lung tissue (2.8 ± 1.1; 4.4 ± 1.1) of ovalbumin-exposed animals (P < 0.05). These findings were positively correlated with lung mechanical responses to antigenic challenge (P < 0.05). In conclusion, inactivation of capsaicin-sensitive nerve fibers reduces pulmonary remodeling, particularly collagen and elastic fibers, which contributes to the attenuation of pulmonary functional parameters.

Correlation between total nitrite/nitrate concentrations and monoamine oxidase (types A and B) and semicarbazide-sensitive amine oxidase enzymatic activities in human mesenteric arteries from non-diabetic and type 2 diabetic patients

The aim of this study was to determine the correlation between total nitrite/nitrate concentrations (NOx) and the kinetic parameters of monoamine oxidase enzymes (MAO-A and MAO-B) and semicarbazide-sensitive amine oxidase (SSAO) in human mesenteric arteries. Arteries were from non-diabetic and type 2 diabetic patients with sigmoid or rectum carcinoma for whom surgery was the first option and who were not exposed to neo-adjuvant therapy. Segments of human inferior mesenteric arteries from non-diabetic (61.1 ± 8.9 years old, 7 males and 5 females, N = 12) and type 2 diabetic patients (65.8 ± 6.2 years old, 8 males and 4 females, N = 12) were used to determine NOx concentrations and the kinetic parameters of MAO-A, MAO-B and SSAO by the Griess reaction and by radiochemical assay, respectively. The NOx concentrations in arteries from diabetic patients did not differ significantly from those of the non-diabetic group (10.28 ± 4.61 vs 10.71 ± 4.32 nmol/mg protein, respectively). In the non-diabetic group, there was a positive correlation between NOx concentrations and MAO-B parameters: Km (r = 0.612, P = 0.034) and Vmax (r = 0.593, P = 0.042), and a negative correlation with the SSAO parameters: Km (r = -0.625, P = 0.029) and Vmax (r = -0.754, P = 0.005). However, in the diabetic group no correlation was found between NOx concentrations and the three kinetic parameters of the enzymes. These results suggest an important function of sympathetic nerves and vascular NOx concentrations in arteries of non-diabetic patients. Thus, these results confirm the importance of a balance between oxidants and antioxidants in the maintenance of vascular homeostasis to prevent oxidative stress.

Partial baroreceptor dysfunction and low plasma nitric oxide bioavailability as determinants of salt-sensitive hypertension: a reverse translational rat study

This study determined whether clinical salt-sensitive hypertension (cSSHT) results from the interaction between partial arterial baroreceptor impairment and a high-sodium (HNa) diet. In three series (S-I, S-II, S-III), mean arterial pressure (MAP) of conscious male Wistar ChR003 rats was measured once before (pdMAP) and twice after either sham (SHM) or bilateral aortic denervation (AD), following 7 days on a low-sodium (LNa) diet (LNaMAP) and then 21 days on a HNa diet (HNaMAP). The roles of plasma nitric oxide bioavailability (pNOB), renal medullary superoxide anion production (RMSAP), and mRNA expression of NAD(P)H oxidase and superoxide dismutase were also assessed. In SHM (n=11) and AD (n=15) groups of S-I, LNaMAP-pdMAP was 10.5±2.1 vs 23±2.1 mmHg (P<0.001), and the salt-sensitivity index (SSi; HNaMAP−LNaMAP) was 6.0±1.9 vs 12.7±1.9 mmHg (P=0.03), respectively. In the SHM group, all rats were normotensive, and 36% were salt sensitive (SSi≥10 mmHg), whereas in the AD group ∼50% showed cSSHT. A 45% reduction in pNOB (P≤0.004) was observed in both groups in dietary transit. RMSAP increased in the AD group on both diets but more so on the HNa diet (S-II, P<0.03) than on the LNa diet (S-III, P<0.04). MAP modeling in rats without a renal hypertensive genotype indicated that the AD*HNa diet interaction (P=0.008) increases the likelihood of developing cSSHT. Translationally, these findings help to explain why subjects with clinical salt-sensitive normotension may transition to cSSHT.

Salt-induced epithelial-to-mesenchymal transition in Dahl salt-sensitive rats is dependent on elevated blood pressure

Dietary salt intake has been linked to hypertension and cardiovascular disease. Accumulating evidence has indicated that salt-sensitive individuals on high salt intake are more likely to develop renal fibrosis. Epithelial-to-mesenchymal transition (EMT) participates in the development and progression of renal fibrosis in humans and animals. The objective of this study was to investigate the impact of a high-salt diet on EMT in Dahl salt-sensitive (SS) rats. Twenty-four male SS and consomic SS-13BN rats were randomized to a normal diet or a high-salt diet. After 4 weeks, systolic blood pressure (SBP) and albuminuria were analyzed, and renal fibrosis was histopathologically evaluated. Tubular EMT was evaluated using immunohistochemistry and real-time PCR with E-cadherin and alpha smooth muscle actin (α-SMA). After 4 weeks, SBP and albuminuria were significantly increased in the SS high-salt group compared with the normal diet group. Dietary salt intake induced renal fibrosis and tubular EMT as identified by reduced expression of E-cadherin and enhanced expression of α-SMA in SS rats. Both blood pressure and renal interstitial fibrosis were negatively correlated with E-cadherin but positively correlated with α-SMA. Salt intake induced tubular EMT and renal injury in SS rats, and this relationship might depend on the increase in blood pressure.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Propofol inhibits burn injury-induced hyperpermeability through an apoptotic signal pathway in microvascular endothelial cells

Recent studies have revealed that an intrinsic apoptotic signaling cascade is involved in vascular hyperpermeability and endothelial barrier dysfunction. Propofol (2,6-diisopropylphenol) has also been reported to inhibit apoptotic signaling by regulating mitochondrial permeability transition pore (mPTP) opening and caspase-3 activation. Here, we investigated whether propofol could alleviate burn serum-induced endothelial hyperpermeability through the inhibition of the intrinsic apoptotic signaling cascade. Rat lung microvascular endothelial cells (RLMVECs) were pretreated with propofol at various concentrations, followed by stimulation with burn serum, obtained from burn-injury rats. Monolayer permeability was determined by transendothelial electrical resistance. Mitochondrial release of cytochrome C was measured by ELISA. Bax and Bcl-2 expression and mitochondrial release of second mitochondrial-derived activator of caspases (smac) were detected by Western blotting. Caspase-3 activity was assessed by fluorometric assay; mitochondrial membrane potential (Δψm) was determined with JC-1 (a potential-sensitive fluorescent dye). Intracellular ATP content was assayed using a commercial kit, and reactive oxygen species (ROS) were measured by dichlorodihydrofluorescein diacetate (DCFH-DA). Burn serum significantly increased monolayer permeability (P<0.05), and this effect could be inhibited by propofol (P<0.05). Compared with a sham treatment group, intrinsic apoptotic signaling activation - indicated by Bax overexpression, Bcl-2 downregulation, Δψm reduction, decreased intracellular ATP level, increased cytosolic cytochrome C and smac, and caspase-3 activation - was observed in the vehicle group. Propofol not only attenuated these alterations (P<0.05 for all), but also significantly decreased burn-induced ROS production (P<0.05). Propofol attenuated burn-induced RLMVEC monolayer hyperpermeability by regulating the intrinsic apoptotic signaling pathway.

Functionalisation of spruce O-acetyl-galactoglucomannans for barrier and composite applications

The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.