929 resultados para SEMICONDUCTOR COMPOUND-CRYSTALS


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Solvent induced single-crystal-to-single-crystal transformation has been demonstrated indicating the dynamic behavior of one dimensional arrays obtained from a self-assembled new synthetic cyclic peptide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reaction of single crystals of benzoic and trans-cinnamic acids with 200 Torr pressure of ammonia gas in a sealed glass bulb at 20 degrees C generates the corresponding ammonium salts; there is no sign of any 1:2 adduct as has been reported previously for related systems. Isotopic substitution using ND3 has been used to aid identification of the products. Adipic acid likewise reacts with NH3 gas to form a product in which ammonium salts are formed at both carboxylic acid groups. Reaction of 0.5 Torr pressure of NO2 gas with single crystals of 9-methylanthracene and 9-anthracenemethanol in a flow system generates nitrated products where the nitro group appears to be attached at the 10-position, i.e. the position trans to the methyl or methoxy substituent on the central ring. Isotopic substitution using (NO2)-N-15 has been used to confirm the identity of the bands arising from the coordinated NO2 group. The products formed when single crystals of hydantoin are reacted with NO2 gas under similar conditions depend on the temperature of the reaction. At 20 degrees C, a nitrated product is formed, but at 65 degrees C this gives way to a product containing no nitro groups. The findings show the general applicability of infrared microspectroscopy to a study of gas-solid reactions of organic single crystals. (c) 2005 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent rapid developments in biological analysis, medical diagnosis, pharmaceutical industry, and environmental control fuel the urgent need for recognition of particular DNA sequences from samples. Currently, DNA detection techniques use radiochemical, enzymatic, fluorescent, or electrochemiluminescent methods; however, these techniques require costly labeled DNA and highly skilled and cumbersome procedure, which prohibit any in-situ monitoring. Here, we report that hybridization of surface-immobilized single-stranded oligonucleotide on praseodymium oxide (evaluated as a biosensor surface for the first time) with complimentary strands in solution provokes a significant shift of electrical impedance curve. This shift is attributed to a change in electrical characteristics through modification of surface charge of the underlying modified praseodymium oxide upon hybridization with the complementary oligonucelotide strand. On the other hand, using a noncomplementary single strand in solution does not create an equivalent change in the impedance value. This result clearly suggests that a new and simple electrochemical technique based on the change in electrical properties of the modified praseodymium oxide semiconductor surface upon recognition and transduction of a biological event without using labeled species is revealed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aromatic poly(ether-ketone)s having pendant carboxyl groups have been obtained by direct, one-pot, Friedel-Crafts copolycondensation of 4,4'-diphenoxybenzophenone with a mixture of terephthaloyl chloride (TC) and trimellitic anhydride acid chloride (TAAC), over a wide range of TAAC/TC molar ratios, in the presence of anhydrous aluminum chloride. The syntheses were performed as precipitation-polycondensations, and the polymers were obtained in particulate form. Besides globular particles of polymer, small quantities of elongated, needlelike particles were observed when the mole ratio TAAC/TC was less than 1. Use of X-ray microdiffraction with synchrotron radiation has revealed that the needlelike material consists of a cyclic compound containing 10 phenylene units, i.e., the crystals are of a [2 + 2] macrocyclic dimer. The polymers obtained are soluble in strong acids and in mixtures of methanesulfonic acid or trifluoroacetic acid with chlorinated hydrocarbons. The molecular structures of the polymers were confirmed by H-1 and C-13 NMR spectroscopy. Reaction of TAAC with 4,4'-diphenoxybenzophenone produced mainly meta-orientation of the resulting ketone linkages. The size of the polymer particles, their molecular weights, and the melting behavior of the products obtained depend on the TAAC/TC ratio used. Ortho-keto acid residues, formed during reaction of anhydride groups of TAAC with 4,4'-diphenoxybenzophenone, exhibit ring-chain tautomerism. A carboxyl-containing aromatic polyketone derived from p-terphenyl, and thus having with no ether linkages in the main chain, was prepared by analogous chemistry, and functional derivatives of carboxy-substituted polyketones were also obtained and characterized.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Electrospinning is a route to polymer fibres with diameters considerably smaller than available from most fibre-producing techniques. We explore the use of a low molecular weight compound as an effective control additive during the electrospinning of poly(epsilon-caprolactone). This approach extends the control variables for the electrospinning of nanoscale fibres from the more usual ones such as the polymer molecular weight, solvent and concentration. We show that through the use of dual solvent systems, we can alter the impact of the additive on the electrospinning process so that finer as well as thicker fibres can be prepared under otherwise identical conditions. As well as the size of the fibres and the number of beads, the use of the additive allows us to alter the level of crystallinity as well as the level of preferred orientation of the poly(epsilon-caprolactone) crystals. This approach, involving the use of a dual solvent and a low molar mass compound, offers considerable potential for application to other polymer systems. (C) 2010 Society of Chemical Industry

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Two Schiff bases, HL1 and HL2 have been prepared by the condensation of N-methyl-1,3-propanediamine (mpn) with salicylaldehyde and 1-benzoylacetone (Hbn) respectively. HL1 on reaction with Cu(ClO4)(2)center dot 6H(2)O in methanol produced a trinuclear Cu-II complex, [(CuL1)(3)(mu(3)-OH)](ClO4)(2)center dot H2O center dot 0.5CH(2)Cl(2) (1) but HL2 underwent hydrolysis under similar reaction conditions to result in a ternary Cu-II complex, [Cu(bn)(mpn)ClO4]. Both complexes have been characterised by single-crystal X-ray analyses, IR and UV-Vis spectroscopy and electrochemical studies. The partial cubane core [Cu3O4] of 1 consists of a central mu(3)-OH and three peripheral phenoxo bridges from the Schiff base. All three copper atoms of the trinuclear unit are five-coordinate with a distorted square-pyramidal geometry. The ternary complex 2 is mononuclear with the square-pyramidal Cu-II coordinated by a chelating bidentate diamine (mpn) and a benzoylacetonate (bn) moiety in the equatorial plane and one of the oxygen atoms of perchlorate in an axial position. The results show that the Schiff base (HL2) derived from 1-benzoylacetone is more prone to hydrolysis than that from salicylaldehyde (HL1). Magnetic measurements of 1 have been performed in the 1.8-300 K temperature range. The experimental data clearly indicate antiferromagnetism in the complex. The best-fit parameters for complex 1 are g = 2.18(1) and J = -15.4(2) cm(-1).

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Endogenous formation of N-nitroso compounds (NOCs), which are known animal carcinogens, could contribute to human carcinogenesis but definitive evidence is still lacking. To investigate the relevance of NOCs in human colorectal cancer (CRC) development, we analyzed whole genome gene expression modifications in human colon biopsies in relation to fecal NOC exposure. We had a particular interest in patients suffering from intestinal inflammation as this may stimulate endogenous NOC formation, and consequently predispose to CRC risk. Inflammatory bowel disease (IBD) patients diagnosed with ulcerative colitis and irritable bowel syndrome patients without inflammation, serving as controls, were therefore recruited. Fecal NOC were demonstrated in the majority of subjects. By associating gene expression levels of all subjects to fecal NOC levels, we identified a NOC exposure-associated transcriptomic response that suggests that physiological NOC concentrations may potentially induce genotoxic responses and chromatin modifications in human colon tissue, both of which are linked to carcinogenicity. In a network analysis, chromatin modifications were linked to 11 significantly modulated histone genes, pointing towards a possible epigenetic mechanism that may be relevant in comprehending NOC-induced carcinogenesis. In addition, pro-inflammatory transcriptomic modifications were identified in visually non-inflamed regions of the IBD colon. However, fecal NOC levels were slightly but not significantly increased in IBD patients, suggesting that inflammation did not strongly stimulate NOC formation. We conclude that NOC exposure is associated with gene expression modifications in the human colon that may suggest a potential role of these compounds in CRC development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We report the synthesis and characterisation of tetrakis(2,4,6-triisopropylphenyl)diphosphine. Synthesis is effected by the treatment of PCl3 with an excess of 2,4,6-triisopropylphenyllithium (or the equivalent Grignard reagent) in 70% yield. While under normal circumstances the triarylphosphine would be expected, excessive bulk prevents this, and the resulting diphosphine is, unusually, stable to PP cleavage by further organolithium moieties. The compound is stable, both thermally (m.p. 185°C) and to air and water in the solid state, although conversion to the equivalent diorganophosphinate ester is effected by boiling ethanolic solutions in air. Crystallisation from hexane/ethanol afforded pale yellow crystals of X-ray quality. The molecule is characterised by m.p., IR, NMR, elemental analysis (C, H, P) and MS. The X-ray structure shows an antiperiplanar conformation with a PP separation of 2.2461(16) Å. Comparisons are made with other diphosphines, the title compound being only the fourth simple diphosphine to be structurally characterised.