999 resultados para Human emancipation
Resumo:
1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.
Resumo:
A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.
Resumo:
Introduction: A resorbable collagen matrix with recombinant human bone morphogenetic protein (rhBMP-2) was compared with traditional iliac crest bone graft for the closure of alveolar defects during secondary dental eruption. Methods: Sixteen patients with unilateral cleft lip and palate, aged 8 to 12 years, were selected and randomly assigned to group 1 (rhBMP-2) or group 2 (iliac crest bone graft). Computed tomography was performed to assess both groups preoperatively and at months 6 and 12 postoperatively. Bone height and defect volume were calculated through Osirix Dicom Viewer (Pixmeo, Apple Inc.). Overall morbidity was recorded. Results: Preoperative and follow-up examinations revealed progressive alveolar bone union in all patients. For group 1, final completion of the defect with a 65.0% mean bone height was detected 12 months postoperatively. For group 2, final completion of the defect with an 83.8% mean bone height was detected 6 months postoperatively. Dental eruption routinely occurred in both groups. Clinical complications included significant swelling in three group 1 patients (37.5%) and significant donor-site pain in seven group 2 patients (87.5%). Conclusions: For this select group of patients with immature skeleton, rhBMP-2 therapy resulted in satisfactory bone healing and reduced morbidity compared with traditional iliac crest bone grafting.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Fibroblasts are thought to be partially responsible for the persisting contractile forces that result in burn contractures. Using a monolayer cell culture and fibroblast populated collagen lattice (FPCL) three-dimensional model we subjected hypertrophic scar and non-cicatricial fibroblasts to the antifibrogenic agent pentoxifylline (PTF - 1 mg/mL) in order to reduce proliferation, collagen types I and III synthesis and model contraction. Fibroblasts were isolated from post-burn hypertrophic scars (HSHF) and non-scarred skin (NHF). Cells were grown in monolayers or incorporated into FPCL`s and exposed to PTF. In monolayer, cell number proliferation was reduced (46.35% in HSHF group and 37.73% in NHF group, p < 0.0001). PTF selectively inhibited collagen III synthesis in the HSHF group while inhibition was more evident to type I collagen synthesis in the NHF group. PTF also reduced contraction in both (HSHF and NHF) FPCL. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.
Resumo:
A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.
Resumo:
We examined the effects of polyarticular juvenile idiopathic arthritis (pJIA) serum on proliferation, differentiation, mineralization, and apoptosis of human osteoblast cells (hOb) in culture. The hOb were cultured with 10% serum from active pJIA and healthy controls (CT) and were tested for DNA synthesis, alkaline phosphatase (AP) activity, osteocalcin (OC) secretion, calcium levels, caspase 3 activity, and DNA fragmentation. None of the patients had used glucocorticoids for at least 1 month before the study, or any other drug that can affect bone mineral metabolism. Human inflammatory cytokine levels (IL-6, IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70) were measured in pJIA and CT sera. Low levels of AP activity was observed in pJIA cultures compared with CT cultures (67.16 +/- 53.35 vs 100.11 +/- 50.64 mu mol p-nitrophenol/h(-1) mg(-1) protein, P=0.008). There was also a significant decrease in OC secretion (9.23 +/- 5.63 vs 12.82 +/- 7.02 ng/mg protein, P=0.012) and calcium levels (0.475 +/- 0.197 vs 0.717 +/- 0.366 mmol/l, P=0.05) in pJIA hOb cultures. No difference was observed in cell proliferation (323.56 +/- 108.23 vs 328.91 +/- 88.03 dpm/mg protein, P=0.788). Osteoblasts cultured with JIA sera showed lower levels of DNA and increased fragmentation than osteoblasts cultured with CT sera. pJIA sera showed higher IL-6 values than CT (21.44 +/- 9.31 vs 3.58 +/- 2.38 pg/ml, P<0.001), but no difference was observed related to IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70 between pJIA and controls. This study suggests that serum from children with pJIA inhibits differentiation, mineralization and may increase apoptosis of hOb cultures, and inflammatory cytokines such as IL-6 might be a mechanism in this find. These results may represent an alternative therapeutic target for prevention and treatment of bone loss in JIA.
Resumo:
Mice expressing human cholesteryl ester transfer protein (huCETP) are more resistant to Escherichia coli bacterial wall LIPS because death rates 5 days after intraperitoneal inoculation of LIPS were higher in wild-type than in huCETP(+/-) mice, whereas all huCETP(+/+) mice remained alive. After LIPS inoculation, plasma concentrations of TNF-alpha and IL-6 increased less in huCETP(+/+) than in wild-type mice. LPS in vitro elicited lower TNF-alpha production by CETP expressing than by wild-type macrophages. In addition, TNF-alpha production by RAW 264.7 murine macrophages increased on incubation with LPS but decreased in a dose-dependent manner when human CETP was added to the medium. Human CETP in vitro enhanced the LIPS binding to plasma high-density lipoprotein/low-density lipoprotein. The liver uptake of intravenous infused C-14-LPS from Salmonella typhimurium was greater in huCETP(+/+) than in wild-type mice. Present data indicate for the first time that CETP is an endogenous component involved in the first line of defense against an exacerbated production of proinflammatory mediators.
Resumo:
P>Human immunodeficiency virus (HIV)-1 protease is a known target of CD8+ T cell responses, but it is the only HIV-1 protein in which no fully characterized HIV-1 protease CD4 epitopes have been identified to date. We investigated the recognition of HIV-1 protease by CD4+ T cells from 75 HIV-1-infected, protease inhibitor (PI)-treated patients, using the 5,6-carboxyfluorescein diacetate succinimidyl ester-based proliferation assay. In order to identify putative promiscuous CD4+ T cell epitopes, we used the TEPITOPE algorithm to scan the sequence of the HXB2 HIV-1 protease. Protease regions 4-23, 45-64 and 73-95 were identified; 32 sequence variants of the mentioned regions, encoding frequent PI-induced mutations and polymorphisms, were also tested. On average, each peptide bound to five of 15 tested common human leucocyte antigen D-related (HLA-DR) molecules. More than 80% of the patients displayed CD4+ as well as CD8+ T cell recognition of at least one of the protease peptides. All 35 peptides were recognized. The response was not associated with particular HLA-DR or -DQ alleles. Our results thus indicate that protease is a frequent target of CD4+ along with CD8+ proliferative T cell responses by the majority of HIV-1-infected patients under PI therapy. The frequent finding of matching CD4+ and CD8+ T cell responses to the same peptides may indicate that CD4+ T cells provide cognate T cell help for the maintenance of long-living protease-specific functional CD8+ T cells.
Resumo:
BACKGROUND: Persons with human immunodeficiency virus (HIV) risk behaviors are excluded from donation to reduce the risk of transfusion-transmitted infection. Persons donating to be tested for HIV may therefore deny risk behaviors. STUDY DESIGN AND METHODS: A random sample of donors completed a survey on motivations, knowledge, and attitudes on the screening process. Donors were considered test seekers if they agreed with two statements ""I think that blood donation is a good, fast, and anonymous way to get my blood tested"" and ""I donate to get my test results."" This study was conducted from June to November 2006 at the largest blood bank in Sao Paulo, Brazil. RESULTS: Of 3061 participants, 208 (7%) were test seekers. They tended to be male and had a lower educational level. They were more likely to have incorrect knowledge about blood safety (e.g., not knowing that a unit can test antibody negative and still transmit infection, 60% vs. 42%, p = 0.02), express dissatisfaction with screening questions (e.g., feeling that important questions were not asked, 14% vs. 5%, p < 0.01), and concur that donors do not answer questions truthfully (e.g., donors have more sexual partners than they admit, 29% vs. 18%, p < 0.01). Test seekers were more likely to believe that it is acceptable to donate blood to get tested for HIV (41% vs. 10%, p < 0.01). CONCLUSIONS: Test-seeking motivation, coupled with low knowledge of window period risk, is counter to improving blood safety and to donor prevention needs. Donor education needs to be improved along with availability of appropriate HIV counseling and testing.
Resumo:
We have established a surviving model of isolated limb perfusion using xenografts of the human melanoma cell line MM 96L injected subcutaneously into the hindlimb of a nude rat, The femoral artery and vein were cannulated via the left renal artery and vein and the hind limb was isolated using tourniquets. The limb was perfused with Krebs Heinseleit buffer at 37 degrees C containing 4.7% bovine serum albumin at a constant flow rate of 4 mi per min for 30-60 min with 100% survival of the animals, Tumour vascularization and blood flow were demonstrated using vascular casts and [Cr-51]-microspheres. Following the addition of melphalan (15 or 100 mu g/ml), drug concentrations in the perfusate, tissues and systemic circulation were determined using high pressure liquid chromatography (HPLC), Systemic leakage, assessed using [I-125]albumin and melphalan and detected by a gamma-counter and HPLC respectively, was <0.5%. The melphalan concentration and tissue flow rate in the tumour deposits were 40 and 30% respectively, when compared with the surrounding subcutaneous tissue, At a dose of 15 mu g/ml, melphalan caused a reduction in tumour growth after 60 min perfusion, and a significant reduction in tumour size was seen when the melphalan dose was 100 mu g/ml. The surviving nude rat model of isolated limb perfusion for recurrent melanoma will allow examination of optimal perfusion conditions, along with the pharmacokinetics, pharmacodynamics and efficacy of melphalan and other drugs.
Resumo:
A line of FVB (H-2(q)) mice transgenic for the E6/E7 open reading frames of Human Papillomavirus type 16 driven from the alpha-A crystallin promoter expresses E7 mRNA in lens and skin epithelium. E7 protein is detectable in adult skin, coinciding with the development or inflammatory skin disease, which progresses to papillomata and squamous carcinomata in some mice. By examining the outcome of parenteral immunization with E7 protein, we sought to determine whether endogenous expression of E7 in skin had induced a preexisting immune outcome, i.e., specific immunity or tolerance, or whether the mice remain naive (''ignorant'') to E7. Our data show that the antibody response to defined E7 B-epitopes, the proliferative response to Th epitopes, and the delayed-type hypersensitivity (DTH) response to whole E7 did not differ between groups or young and old E6/E7 transgenic mice (likely having different degrees of lifetime exposure to E7 protein) or between E6/E7-transgenic and nontransgenic parental strain control mice. Although an E7-specific CTL response could not be induced in the H-2(q) background of these mice, incorporation of a D-b allele into the genome allowed comparison of D-b-restricted CTL responses in E6/E7 transgenic and nontransgenic mice. Experiments indicated that the E7-immunization-induced CTL response did not differ significantly between E6/E7 transgenic and nontransgenic mice. We interpret these results to indicate that in spite of expression of E7 protein in adult skin, E6/E7 transgenic mice remain immunologically naive (ignorant) of E7 epitopes presented by immunization. (C) 1997 Academic Press.
Resumo:
The aim of this study was to prospectively investigate the peak levels and kinetics of donor leucocyte chimerism in human recipients following liver transplantation, The peak levels of chimerism mere observed within the first 48 hours following transplantation and ranged from 0.15% to 20% of total peripheral blood mononuclear cells, In all but one patient, who developed graft versus host disease, there was an early peak level of chimerism that declined over time such that donor leukocytes mere only intermittently detectable after 3 to 4 weeks. In 8 patients who had no episodes of graft rejection, the peak level of donor leukocyte chimerism ranged from 1.3% to 20% (mean +/- SEM; 5.5% +/- 2.1%). In 3 patients who were treated for episodes of acute graft rejection during the first four postoperative weeks, the peak level of donor leukocyte chimerism ranged from 0.15% to 0.2% (0.18 +/- 0.02, P = .012), The results demonstrate a marked variation in the total number of donor leukocytes detectable in the peripheral blood early after liver transplantation and also, that lower levels of chimerism may be associated with lower rates of initial graft acceptance and a higher incidence of acute rejection.