799 resultados para Human anatomy -- Study and teaching (Higher)
Resumo:
We generalize a standard technology diffusion model by allowing for IPRs regimes to be endogenously defined by the development level of each country. Also we insert differences in the composition of human capital between North (leader) and South (followers) which shape the relative costs of innovation and imitation. Results show how an optimal growth trajectory is found for the follower country which initially imitates and that, once a "threshold development stage" is reached, optimally switches to innovation by fully enforcing IPRs achieving a higher proximity with the technology frontier in the long-run. Other scenarios, such as a premature increase in the enforcement of IPRs or a switch from imitation to innovation at early stages of development of the followers are found to be sub-optimal.
Resumo:
This study reveals that a successful ethnobotanical survey can take place still nowadays, even close to one of the hotspots of tourism in the Mediterranean coast. This is the first approach in this field entirely based on interviews with local people in Mallorca. An amount of 235 informants has been inquired from all the 53 municipalities of the island. The data collected have been analyzed from the botanical and ethnographical points of view, and managed using the online platform of our research team (details at www.etnobiofic.cat). The Mallorcan ethnopharmacopoeia includes 255 plant taxa referring more than 150 medicinal use categories. Ethnomedical queries as the one here presented contribute to the knowledge of the traditional use of plants of the island and appreciate the benefits of this knowledge, applied to the present and future of its society.
Resumo:
This study reveals that a successful ethnobotanical survey can take place still nowadays, even close to one of the hotspots of tourism in the Mediterranean coast. This is the first approach in this field entirely based on interviews with local people in Mallorca. An amount of 235 informants has been inquired from all the 53 municipalities of the island. The data collected have been analyzed from the botanical and ethnographical points of view, and managed using the online platform of our research team (details at www.etnobiofic.cat). The Mallorcan ethnopharmacopoeia includes 255 plant taxa referring more than 150 medicinal use categories. Ethnomedical queries as the one here presented contribute to the knowledge of the traditional use of plants of the island and appreciate the benefits of this knowledge, applied to the present and future of its society.
Resumo:
This article suggests the study of the key concept of conflict as a means of implementing a critical and communicativecurriculum based on the study of relevant social themes. To this end we put forward the principal characteristics of thecritical/communicative curriculum. We offer a didactic proposal about conflict and explain the results of its application intwo Secondary Education classrooms
Resumo:
The study focuses on primary school teachers’ perceptions of environmental education, its integration into primary school education and teachers’ teaching practices in Tanzania. The thesis is based on empirical research. The theoretical underpinnings of the study are based on Palmer’s (1998) model of environmental education. According to the model, meaningful environmental education should include education about, in or through and for the environment. The study is supported by national and international literature from research done on environmental education and education for sustainable development and policy statements. The study is qualitative in nature, adopting phenomenography and phenomenology as points of departure. The empirical data was collected from four primary schools in Morogoro region in Tanzania. The study sample consisted of 31 primary school teachers. Data was collected through interviews and lesson observations. According to the results of the study, primary school teachers expressed variations in their perceptions of environmental education and education for sustainable development. Most of the teachers focused on the aspect of knowledge acquisition. According to Tanzanian education and training policy, environmental education has to be integrated into all subjects. Although there is environmental education in the primary school curriculum, it is not integrated on an equal footing in all subjects. Some subjects like science, social studies and geography have more environmental content than other subjects. Teachers claim that the approach used to integrate environmental education into the school curriculum was not favoured because many claimed that what is to be taught as environmental education in the various subjects is not shown clearly. As a result, many teachers suggested that to ensure that it is taught properly it should be included in the curriculum as an independent subject or as specific topics. The study revealed that teachers’ teaching practices in integrating environmental education varied from one subject to another. Although most of the teachers said that they used participatory methods, lesson observations showed that they limited themselves to question and answer and group discussion. However, the teachers faced a number of barriers in the teaching of environmental education, some of which include lack of teaching and learning resources, time and large class size. The role of teachers in the implementation of environmental education in developing an environmentally literate citizenry is of great significance. The responsibility of the government in developing a curriculum with clear goals and content, developing teachers’ capacity in the teaching of environmental education and provision of teaching and learning materials needs to be taken seriously by the government in educational plans and programs.
Resumo:
PURPOSE: To determine anatomical and functional pelvic floor measurements performed with three-dimensional (3-D) endovaginal ultrasonography in asymptomatic nulliparous women without dysfunctions detected in previous dynamic 3-D anorectal ultrasonography (echo defecography) and to demonstrate the interobserver reliability of these measurements. METHODS: Asymptomatic nulliparous volunteers were submitted to echo defecography to identify dynamic dysfunctions, including anatomical (rectocele, intussusceptions, entero/sigmoidocele and perineal descent) and functional changes (non-relaxation or paradoxical contraction of the puborectalis muscle) in the posterior compartment and assessed with regard to the biometric index of levator hiatus, pubovisceral muscle thickness, urethral length, anorectal angle, anorectal junction position and bladder neck position with the 3-D endovaginal ultrasonography. All measurements were compared at rest and during the Valsalva maneuver, and perineal and bladder neck descent was determined. The level of interobserver agreement was evaluated for all measurements. RESULTS: A total of 34 volunteers were assessed by echo defecography and by 3-D endovaginal ultrasonography. Out of these, 20 subjects met the inclusion criteria. The 14 excluded subjects were found to have posterior dynamic dysfunctions. During the Valsalva maneuver, the hiatal area was significantly larger, the urethra was significantly shorter and the anorectal angle was greater. Measurements at rest and during the Valsalva maneuver differed significantly with regard to anorectal junction and bladder neck position. The mean values for normal perineal descent and bladder neck descent were 0.6 cm and 0.5 cm above the symphysis pubis, respectively. The intraclass correlation coefficient ranged from 0.62-0.93. CONCLUSIONS: Functional biometric indexes, normal perineal descent and bladder neck descent values were determined for young asymptomatic nulliparous women with the 3-D endovaginal ultrasonography. The method was found to be reliable to measure pelvic floor structures at rest and during Valsalva, and might therefore be suitable for identifying dysfunctions in symptomatic patients.
Resumo:
This dissertation critically reviews the idea of meritocracy from both a theoretical and an empirical perspective. Based on a discussion of classical texts of social philosophy and sociology, it is argued that meritocracy as a concept for social stratification is best compatible with the sociological tradition of status attainment research: both frame social inequality in primarily individualistic terms, centring on the role of ascribed (e.g., gender, social background) and achieved (e.g., educational qualifications) characteristics for determining individuals’ socioeconomic rewards. This theoretical argument introduces the research problem at the core of this dissertation: to what extent can the individualistic conception of social stratification be maintained empirically? Fields of study and their interaction with educational attainment levels play a prominent role in the analysis of this question. Drawing on sociological versions of segmented labour market theory, it is assumed that fields of study may channel individuals into heterogeneous political-economic contexts on the labour market, which potentially modify the socioeconomic benefit individuals derive from their qualification levels. The focus on fields of study may also highlight economic differentials between men and women that derive from the persisting segregation of men’s and women’s occupational and educational specializations rather than direct gender discrimination on the labour market. The quantitative analyses in this dissertation consist of three research articles, which are based primarily on Finnish data, but occasionally extend the view to other European countries. The data sources include register-based macro- and microdata as well as survey data. Article I examines the extent and the patterns of gender segregation within the Finnish educational system between 1981 and 2005. The results show that differences between men’s and women’s field specializations have for the most part remained stable during this period, with particularly high levels of gender segregation observed at lower educational levels. The focus in Article II rests on the effects of gender-segregated fields of study on higher education graduates’ occupational status. It is shown that fields of study matter for accessing professional jobs and avoiding low-skilled positions in Finland: at the early career stage, particularly polytechnic graduates from female-dominated fields are less likely to work in professional positions. Finnish university graduates from male-dominated fields were more likely than their peers with different specializations to work as professionals, yet they also faced a greater risk of being sorted into lowskilled jobs if they failed to make use of this advantage. Article III proceeded to analyse the joint impact of educational qualification levels and fields of study on young adults’ median earnings in Finland between 1985 and 2005. The results show that qualification levels do not confer a consistent benefit in the process of earnings stratification. Advanced qualifications raise median earnings most clearly among individuals specializing in the same field of study. When comparing individuals with different field specializations, on the other hand, higher-level qualifications do not necessarily lead to higher median earnings. Overall, the findings of this dissertation reveal a heterogeneous effect of education for achieving social positions, which challenges individual-centred, meritocratic accounts of social stratification and underlines the problematic lack of structural and institutional dimensions in the dominant account of social status attainment.
Resumo:
The etiopathogenesis of vulvar intraepithelial neoplasia (VIN III) and invasive squamous cell carcinoma are largely unknown. Since there are few studies on Brazilian patients, our purpose was to determine the frequency of human papillomavirus (HPV) infection and the expression of p53 in these lesions, and associate them with other factors such as age, morphological subtypes, multicentric and multifocal disease. Thirty-eight cases of VIN III, nine of superficially invasive carcinoma, and 55 of invasive vulvar carcinoma were retrospectively evaluated from 1983 to 1995 for the presence of HPV by immunohistochemistry and in situ hybridization, and for p53 protein expression by immunohistochemistry on paraffin sections. All cases for whom material (slides and paraffin blocks) and clinical data were available were included. HPV and p53 were detected in 57.9 and 21.1% of the VIN III lesions, 33.3 and 66.7% of superficially invasive carcinomas, and 7.3 and 58.2% of invasive squamous cell carcinomas, respectively. HPV infection was associated with younger age in the VIN III and invasive carcinoma groups. In the latter, HPV infection was associated with the basaloid variant. p53 expression rate was higher in superficially invasive and invasive lesions and was not related to HPV infection. Our findings are similar to others and support the hypothesis that there are two separate entities of the disease, one associated with HPV and the other unrelated, with p53 inactivation possibly being implicated in some of the cases.
Resumo:
Women living in Latin American countries bear a disproportionate burden of cervical cancer, a condition caused by infection with the human papillomavirus (HPV). We performed a study in Santa Elena, Guayas (currently Santa Elena Province), Ecuador, to determine how often HPV could be detected in women attending a private cancer screening clinic. Participants underwent a Pap test, and vaginal and cervical swabs were performed for HPV testing by the polymerase chain reaction (PCR). Each participant completed a verbally administered survey. The mean age of 302 participants was 37.7 years (range 18 to 78 years). The majority of cervical and vaginal specimens contained sufficient DNA to perform PCR. Overall, 24.2% of the participants had either a cervical or vaginal swab that tested positive for HPV. In general, there was a good correlation between the HPV types detected in the cervical and vaginal swabs from the participants, but vaginal swabs were more likely to contain HPV DNA than were cervical swabs. The high-risk HPV types 16, 52, 58, and 59 and the low-risk HPV types 62, 71, 72, and 83 were the most frequently detected HPV types. The number of lifetime sexual partners was positively associated with detection of any HPV type, detection of oncogenic HPV, and abnormal Pap smears. Further studies are needed to determine if these results are representative of all Ecuadorian women and to determine if cervical cancers in Ecuadorian women are caused by the same HPV types found in the swab specimens obtained in this study.
Resumo:
Esophageal cancer is a prevalent cancer worldwide. Some studies have reported the possible etiology of human papillomavirus (HPV) in benign and malignant papillomas of the esophagus but the conclusions are controversial. In the present study, we investigated an esophageal papilloma from a 30-year-old male patient presenting aphasia. HPV DNA was detected by generic PCR using MY09/11 primers, and restriction fragment length polymorphism revealed the presence of HPV54, usually associated with benign genital lesions. Hypermethylation of the pINK4A gene was also investigated due to its relation to malignant transformation, but no modification was detected in the host gene. Except for an incipient reflux, no risk factors such as cigarette smoking, alcohol abuse or an infected sexual partner were recorded. Since esophageal lesions may have a malignant potential, HPV detection and typing are useful tools for patient follow-up.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
This research responds to a pervasive call for our educational institutions to provide students with literacy skills, and teachers with the instructional supports necessary to facilitate this skill acquisition. Questions were posed to gain information concerning the efficacy ofteaching literacy strategies to students with learning difficulties, the impact of this training on their volunteer tutors, and the influence of this experience on these tutors' ensuing instructional practice as teacher candidates in a preservice education program. Study #1 compared a nontreatment group of students with literacy difficulties who participated in the program and found that program participants were superior at reading letter patterns and at comprehending the elements of story grammar. Concurrently, the second study explored the experiences of 19 volunteer tutors and uncovered that they acquired instructional skills as they established a knowledge base in teaching reading and writing, and they affirmed personal goals to become future teachers. Study #3 tracked 6 volunteer tutors into their pre-service year and identified their constructions, and beliefs about literacy instruction. These teacher candidates discussed how they had intended to teach reading and writing strategies based on their position that effective teaching ofthese skills in the primary grades is integral to academic success. The teacher candidates emphasized the need to build rapport with students, and the need to exercise flexibility in lesson plan delivery while including activities to meet emotional and developmental requirements of students. The teacher candidates entered their pre-service education with an initial cognition set based on the limited teaching context of tutoring. This foundational ii perception represented their prior knowledge of literacy instruction, a perception that appeared untenable once they were immersed in a regular instructional setting. This disparity provoked some of the teacher candidates to denounce their teacher mentors for not consistently employing literacy strategies and individualized instruction. This critical perspective could have been a demonstration of cognitive dissonance. In the end, when the teacher candidates began to look toward the future and how they would manage the demands of an inclusive classroom, they recognized the differences in the contexts. With an appreciation for the need for balance between prior and present knowledge, the teacher candidates remained committed to implementing their tutoring strategies in future teaching positions. This document highlights the need for teacher candidates with instructional experience prior to teacher education, to engage in cognitive negotiations to assimilate newly acquired pedagogies into existing pedagogies.
Resumo:
This study was an investigation of individual and organizational factors, as perceived by front-line vocational service workers from Adult Rehabilitation Centres (ARC Industries) for mentally retarded adults. The specific variables which were measured included role conflict/role ambiguity (role factors), internal/external locus of control (individual differences), job satisfaction with work and supervision (job attitudes) and participation in deci~ion making (organizational factor). The exploration of these constructs was conducted by means of self-report questionnaires which were completed by sixty-nine out of a total of ninety front-line employees. The surveys were distributed in booklet form to nine distinct rehabilitation facilities from St. Catharines, West Lincoln, Greater Niagara, Port Colborne, WeIland, Fort Erie, Hamilton, Guelph and Brantford. The survey data was evaluated by the statisti.cal Package for the Social Sciences (SPSS) which used the Pearson Product Moment Correlation procedure and a compar~son of means test. A comparison of correlation coefficients test was also conducted. This statistical procedure was calculated mathematically. The results obtained from the statistical evaluation confirmed the prediction that self-reported measures of participation in decision making and satisfaction (work and supervision) would be negatively correlated with role conflict and role ambiguity. As well, the speculation that perceived satisfaction (work and supervision) would be positively correlated with participation in decision making was empirically supported. Internal and external locus of control did not contribute to a significant difference in r~sponses to role perceptions (conflict and ambiguity) , satisfaction (work and supervision) or the correlational relationship between participation in decision making and satisfaction (work and supervision). Overall, the findings from this study substantiated the importance of examining employee perceptions in the workplace and the interrelationships among individual and organizational variables. This research was considered a contribution to the general area of occupational stress and to the study of individuals in work organizations.
Resumo:
Thesis (M.Ed.)--Brock University, 2003.
Resumo:
Two Grade 3 classes were used to study the effects of a formal social skills training program. Specifically, comparisons were made on self-esteem, classroom environment, and moral development to see whether changes occurred as a direct result of social skills training. One group participated in the social skills program, while the other group did not. It was hypothesized that formal social skills training would improve students' selfesteem, moral development, and the classroom environment. At the end of the program, however, data from class observations, teacher interviews, journal of the social skills training group teacher, and measures of self-esteem, classroom environment and moral development did not support this hypothesis. Although the social skills training group scored significantly higher in class cohesiveness, they did not show marked improvement in the other measures. In fact, in some measures (e.g., friction and competitiveness), they demonstrated greater scores at both pretest and posttests. The social skills training group was, however, able to vocalize and utilize the strategies of several skills which had been a focus of the program, suggesting that formal social skills training is a useful tool for presenting and reinforcing some specific behaviours.