972 resultados para HUMAN GINGIVAL FIBROBLASTS
Resumo:
Human cytomegalovirus (CMV) replication begins with the expression of two regulatory proteins, IE1(491aa) and IE2(579aa), produced from differentially spliced transcripts under control of the ie1/ie2 promoter-enhancer. A deletion mutation removing all 406 IE1(491aa)-specific amino acids was engineered into the viral genome and this mutant (RC303 delta Acc) was propagated on an IE1(491aa)-expressing human fibroblast cell line (ihfie1.3). RC303 delta Acc failed to replicate on normal human fibroblasts at low multiplicities of infection (mois). At mois > 3 plaque-forming units per cell, virus replication and production of progeny were comparable to wild type. However, at mois between 0.01 and 1, mutant virus replicated slowly on normal fibroblasts, a pattern that suggested initiation of productive infection required multiple hits. Replication of RC303 delta Acc correlated with the ability to express IE2(579aa), consistent with a role for IE1(491aa) in positive autoregulation of the ie1/ie2 promoter-enhancer and with data suggesting that virion transactivators compensate for the lack of IE1(491aa) under high moi conditions. ie1-deficient CMV should be completely avirulent, suggesting its utility as a gene therapy vector for hematopoietic progenitors that are normal sites of CMV latency.
Resumo:
Graves disease is an autoimmune thyroid disease characterized by the presence of antibodies against the thyrotropin receptor (TSHR), which stimulate the thyroid to cause hyperthyroidism and/or goiter. By immunizing mice with fibroblasts transfected with both the human TSHR and a major histocompatibility complex class II molecule, but not by either alone, we have induced immune hyperthyroidism that has the major humoral and histological features of Graves disease: stimulating TSHR antibodies, thyrotropin binding inhibiting immunoglobulins, which are different from the stimulating TSHR antibodies, increased thyroid hormone levels, thyroid enlargement, thyrocyte hypercellularity, and thyrocyte intrusion into the follicular lumen. The results suggest that the aberrant expression of major histocompatibility complex class II molecules on cells that express a native form of the TSHR can result in the induction of functional anti-TSHR antibodies that stimulate the thyroid. They additionally suggest that the acquisition of antigen-presenting ability on a target cell containing the TSHR can activate T and B cells normally present in an animal and induce a disease with the major features of autoimmune Graves.
Resumo:
The differentiation of small intestinal epithelial cells may require stimulation by microenvironmental factors in vivo. In this study, the effects of mesenchymal and luminal elements in nonmalignant epithelia] cells isolated from the human fetus were studied in vitro. Enterocytes from the human fetus were cultured and microenvironmental factors were added in stages, each stage more closely approximating the microenvironment in vivo. Four stages were examined: epithelial cells derived on plastic from intestinal culture and grown as a cell clone, the same cells grown on connective tissue support, primary epithelial explants grown on fibroblasts with a laminin base, and primary epithelial explants grown on fibroblasts and laminin with n-butyrate added to the incubation medium. The epithelial cell clone dedifferentiated when grown on plastic; however, the cells expressed cytokeratins and villin as evidence of their epithelial cell origin. Human connective tissue matrix from Engelbreth-Holm-Swarm sarcoma cells (Matrigel) modulated their phenotype: alkaline phosphatase activity increased, microvilli developed on their apical surface, and the profile of insulin-like growth factor binding proteins resembled that secreted by differentiated enterocytes. Epithelial cells taken directly from the human fetus as primary cultures and grown as explants on fibroblasts and laminin expressed greater specific enzyme activities in brush border membrane fractions than the cell clone. These activities were enhanced by the luminal molecule sodium butyrate. Thus the sequential addition of connective tissue and luminal molecules to nonmalignant epithelia] cells in vitro induces a spectrum of changes in the epithelial cell phenotype toward full differentiation.
Resumo:
Human gene MAGE-1 encodes tumor-specific antigens that are recognized on melanoma cells by autologous cytolytic T lymphocytes. This gene is expressed in a significant proportion of tumors of various histological types, but not in normal tissues except male germ-line cells. We reported previously that reporter genes driven by the MAGE-1 promoter are active not only in the tumor cell lines that express MAGE-1 but also in those that do not. This suggests that the critical factor causing the activation of MAGE-1 in certain tumors is not the presence of the appropriate transcription factors. The two major MAGE-1 promoter elements have an Ets binding site, which contains a CpG dinucleotide. We report here that these CpG are demethylated in the tumor cell lines that express MAGE-1, and are methylated in those that do not express the gene. Methylation of these CpG inhibits the binding of transcription factors, as seen by mobility shift assay. Treatment with the demethylating agent 5-aza-2'-deoxycytidine activated gene MAGE-1 not only in tumor cell lines but also in primary fibroblasts. Finally, the overall level of CpG methylation was evaluated in 20 different tumor cell lines. It was inversely correlated with the expression of MAGE-1. We conclude that the activation of MAGE-1 in cancer cells is due to the demethylation of the promoter. This appears to be a consequence of a genome-wide demethylation process that occurs in many cancers and is correlated with tumor progression.
Resumo:
The silver-haired bat variant of rabies virus (SHBRV) has been identified as the etiological agent of a number of recent human rabies cases in the United States that are unusual in not having been associated with any known history of conventional exposure. Comparison of the different biological and biochemical properties of isolates of this virus with those of a coyote street rabies virus (COSRV) revealed that there are unique features associated with SHBRV. In vitro studies showed that, while the susceptibility of neuroblastoma cells to infection by both viruses was similar, the infectivity of SHBRV was much higher than that of COSRV in fibroblasts (BHK-21) and epithelial cells (MA-104), particularly when these cells were kept at 34 degrees C. At this temperature, low pH-dependent fusion and cell-to-cell spread of virus is seen in BHK-21 cells infected with SHBRV but not with COSRV. It appears that SHBRV may possess an unique cellular tropism and the ability to replicate at lower temperature, allowing a more effective local replication in the dermis. This hypothesis is supported by in vivo results which showed that while SHBRV is less neurovirulent than COSRV when administered via the intramuscular or intranasal routes, both viruses are equally neuroinvasive if injected intracranially or intradermally. Consistent with the above findings, the amino acid sequences of the glycoproteins of SHBRV and COSRV were found to have substantial differences, particularly in the region that contains the putative toxic loop, which are reflected in marked differences in their antigenic composition. Nevertheless, an experimental rabies vaccine based on the Pittman Moore vaccine strain protected mice equally well from lethal doses of SHBRV and COSRV, suggesting that currently used vaccines should be effective in the postexposure prophylaxis of rabies due to SHBRV.
Resumo:
Neuroblastoma (NB) is characterized by the second highest spontaneous regression of any human malignant disorder, a phenomenon that remains to be elucidated. In this study, a survey of 94 normal human adult sera revealed a considerable natural humoral cytotoxicity against human NB cell lines in approximately one-third of the tested sera of both genders. Specific cell killing by these sera was in the range of 40% to 95%. Serum cytotoxicity was dependent on an intact classical pathway of complement. By several lines of evidence, IgM antibodies were identified as the cytotoxic factor in the sera. Further analyses revealed that a 260-kDa protein was recognized by natural IgM of cytotoxic sera in Western blots of NB cell extracts. The antigen was expressed on the surface of seven human NB cell lines but not on human melanoma or other control tumor cell lines derived from kidney, pancreas, colon, bone, skeletal muscle, lymphatic system, and bone marrow. Furthermore, no reactivity was observed with normal human fibroblasts, melanocytes, and epidermal keratinocytes. The antigen was expressed in vivo as detected by immunohistochemistry in both the tumor of a NB patient and NB tumors established in nude rats from human NB cell lines. Most interestingly, the IgM anti-NB antibody was absent from the sera of 11 human NB patients with active disease. The anti-NB IgM also could not be detected in tumor tissue obtained from a NB patient. Collectively, our data suggest the existence of a natural humoral immunological tumor defense mechanism, which could account for the in vivo phenomenon of spontaneous NB tumor regression.
Resumo:
A major goal of experimental and clinical hematology is the identification of mechanisms and conditions that support the expansion of transplantable hematopoietic stem cells. In normal marrow, such cells appear to be identical to (or represent a subset of) a population referred to as long-term-culture-initiating cells (LTC-ICs) so-named because of their ability to produce colony-forming cell (CFC) progeny for > or = 5 weeks when cocultured with stromal fibroblasts. Some expansion of LTC-ICs in vitro has recently been described, but identification of the factors required and whether LTC-IC self-renewal divisions are involved have remained unresolved issues. To address these issues, we examined the maintenance and/or generation of LTC-ICs from single CD34+ CD38- cells cultured for variable periods under different culture conditions. Analysis of the progeny obtained from cultures containing a feeder layer of murine fibroblasts engineered to produce steel factor, interleukin (IL)-3, and granulocyte colony-stimulating factor showed that approximately 20% of the input LTC-ICs (representing approximately 2% of the original CD34+ CD38- cells) executed self-renewal divisions within a 6-week period. Incubation of the same CD34+ CD38- starting populations as single cells in a defined (serum free) liquid medium supplemented with Flt-3 ligand, steel factor, IL-3, IL-6, granulocyte colony-stimulating factor, and nerve growth factor resulted in the proliferation of initial cells to produce clones of from 4 to 1000 cells within 10 days, approximately 40% of which included > or = 1 LTC-IC. In contrast, in similar cultures containing methylcellulose, input LTC-ICs appeared to persist but not divide. Overall the LTC-IC expansion in the liquid cultures was 30-fold in the first 10 days and 50-fold by the end of another 1-3 weeks. Documentation of human LTC-IC self-renewal in vitro and identification of defined conditions that permit their extensive and rapid amplification should facilitate analysis of the molecular mechanisms underlying these processes and their exploitation for a variety of therapeutic applications.
Resumo:
In human immunodeficiency virus type 1-infected cells, the efficient expression of viral proteins from unspliced and singly spliced RNAs is dependent on two factors: the presence in the cell of the viral protein Rev and the presence in the viral RNA of the Rev-responsive element (RRE). We show here that the HIV-1 Rev/RRE system can increase the expression of avian leukosis virus (ALV) structural proteins in mammalian cells (D-17 canine osteosarcoma) and promote the release of mature ALV virions from these cells. In this system, the Rev/RRE interaction appears to facilitate the export of full-length unspliced ALV RNA from the nucleus to the cytoplasm, allowing increased production of the ALV structural proteins. Gag protein is produced in the cytoplasm of the ALV-transfected cells even in the absence of a Rev/RRE interaction. However, a functional Rev/RRE interaction increases the amount of Gag present intracellularly and, more strikingly, results in the release of mature ALV particles into the supernatant. RCAS virus containing an RRE is replication-competent in chicken embryo fibroblasts; however, we have been unable to determine whether the particles produced in D-17 cells are as infectious as the particles produced in chicken embryo fibroblasts.
Resumo:
The RII beta regulatory subunit of cAMP-dependent protein kinase (PKA) contains an autophosphorylation site and a nuclear location signal, KKRK. We approached the structure-function analysis of RII beta by using site-directed mutagenesis. Ser114 (the autophosphorylation site) of human RII beta was replaced with Ala (RII beta-P) or Arg264 of KKRK was replaced with Met (RII beta-K). ras-transformed NIH 3T3 (DT) cells were transfected with expression vectors for RII beta, RII beta-P, and RII beta-K, and the effects on PKA isozyme distribution and transformation properties were analyzed. DT cells contained PKA-I and PKA-II isozymes in a 1:2 ratio. Over-expression of wild-type or mutant RII beta resulted in an increase in PKA-II and the elimination of PKA-I. Only wild-type RII beta cells demonstrated inhibition of both anchorage-dependent and -independent growth and phenotypic change. The growth inhibitory effect of RII beta overexpression was not due to suppression of ras expression but was correlated with nuclear accumulation of RII beta. DT cells demonstrated growth inhibition and phenotypic change upon treatment with 8-Cl-cAMP. RII beta-P or RII beta-K cells failed to respond to 8-Cl-cAMP. These data suggest that autophosphorylation and nuclear location signal sequences are integral parts of the growth regulatory mechanism of RII beta.
Resumo:
We recently isolated human cDNA fragments that render MCF-7 breast cancer cells resistant to cell death caused by Pseudomonas exotoxin, Pseudomonas exotoxin-derived immunotoxins, diphtheria toxin, and tumor necrosis factor. We report here that one of these fragments is an antisense fragment of a gene homologous to the essential yeast chromosome segregation gene CSE1. Cloning and analysis of the full-length cDNA of the human CSE1 homologue, which we name CAS for cellular apoptosis susceptibility gene, reveals a protein coding region with similar length (971 amino acids for CAS, 960 amino acids for CSE1) and 59% overall protein homology to the yeast CSE1 protein. The conservation of this gene indicates it has an important function in human cells consistent with the essential role of CSE1 in yeast. CAS is highly expressed in human tumor cell lines and in human testis and fetal liver, tissues that contain actively dividing cells. Furthermore, CAS expression increases when resting human fibroblasts are induced to proliferate and decreases when they are growth-arrested. Thus, CAS appears to play an important role in both toxin and tumor necrosis factor-mediated cell death, as well as in cell proliferation.
Resumo:
Total glycans from the cell layer and the culture medium of human vascular smooth muscle cells (VSMC) that had been cultivated in the presence of platelet-derived growth factor (PDGF) were isolated and purified by gel filtration after Pronase and DNase digestion and alkaliborohydride treatment. Measurements of the content of neutral hexoses and uronic acids revealed that PDGF stimulates total glycan synthesis by proliferating VSMC in a linear fashion from 24 h to 72 h of incubation. In contrast, total glycan synthesis by human fibroblasts, epithelial cells, or endothelial cells was not affected by PDGF, indicating cell-type specificity. Chemical, biochemical, and enzymological characterization of the total glycans synthesized by VSMC showed that PDGF stimulates the secretion of a 340-kDa glycan molecule in a time-dependent manner from 24 h to 72 h. This molecule is highly acidic, shares a common structure with hyaluronic acid, and exhibits a potent antiproliferative activity on VSMC. These results suggest that VSMC in response to PDGF are capable of controlling their own growth and migration by the synthesis of a specific form of hyaluronic acid with antiproliferative potency, which may be involved in the regulation of the local inflammatory responses associated with atherosclerosis.
Resumo:
Normal somatic cells invariably enter a state of irreversibly arrested growth and altered function after a finite number of divisions. This process, termed replicative senescence, is thought to be a tumor-suppressive mechanism and an underlying cause of aging. There is ample evidence that escape from senescence, or immortality, is important for malignant transformation. By contrast, the role of replicative senescence in organismic aging is controversial. Studies on cells cultured from donors of different ages, genetic backgrounds, or species suggest that senescence occurs in vivo and that organismic lifespan and cell replicative lifespan are under common genetic control. However, senescent cells cannot be distinguished from quiescent or terminally differentiated cells in tissues. Thus, evidence that senescent cells exist and accumulate with age in vivo is lacking. We show that several human cells express a beta-galactosidase, histochemically detectable at pH 6, upon senescence in culture. This marker was expressed by senescent, but not presenescent, fibroblasts and keratinocytes but was absent from quiescent fibroblasts and terminally differentiated keratinocytes. It was also absent from immortal cells but was induced by genetic manipulations that reversed immortality. In skin samples from human donors of different age, there was an age-dependent increase in this marker in dermal fibroblasts and epidermal keratinocytes. This marker provides in situ evidence that senescent cells may exist and accumulate with age in vivo.
Resumo:
We have examined whether the secretion of erythropoietin (Epo) from genetically modified cells could represent an alternative to repeated injections of the recombinant hormone for treating chronic anemias responsive to Epo. Primary mouse skin fibroblasts were transduced with a retroviral vector in which the murine Epo cDNA is expressed under the control of the murine phosphoglycerate kinase promoter. "Neo-organs" containing the genetically modified fibroblasts embedded into collagen lattices were implanted into the peritoneal cavity of mice. Increased hematocrit (> 80%) and elevated serum Epo concentration (ranging from 60 to 408 milliunits/ml) were observed in recipient animals over a 10-month observation period. Hematocrit values measured in recipient mice varied according to the number of implanted Epo-secreting fibroblasts (ranging from 2.5 to 20 x 10(6)). The implantation of neo-organs containing Epo-secreting fibroblasts appeared, therefore, as a convenient method to achieve permanent in vivo delivery of the hormone. We estimated that the biological efficacy of the approach may be relevant for the treatment of human hemoglobinopathies.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Retinitis pigmentosa (RP) represents a genetically heterogeneous group of retinal dystrophies affecting mainly the rod photoreceptors and in some instances also the retinal pigment epithelium (RPE) cells of the retina. Clinical symptoms and disease progression leading to moderate to severe loss of vision are well established and despite significant progress in the identification of causative genes, the disease pathology remains unclear. Lack of this understanding has so far hindered development of effective therapies. Here we report successful generation of human induced pluripotent stem cells (iPSC) from skin fibroblasts of a patient harboring a novel Ser331Cysfs*5 mutation in the MERTK gene. The patient was diagnosed with an early onset and severe form of autosomal recessive RP (arRP). Upon differentiation of these iPSC towards RPE, patient-specific RPE cells exhibited defective phagocytosis, a characteristic phenotype of MERTK deficiency observed in human patients and animal models. Thus we have created a faithful cellular model of arRP incorporating the human genetic background which will allow us to investigate in detail the disease mechanism, explore screening of a variety of therapeutic compounds/reagents and design either combined cell and gene- based therapies or independent approaches.