937 resultados para Formation of the literacy teacher literator


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Summary Apicomplexan parasites within the genus Theileria have the ability to induce continuous proliferation and prevent apoptosis of the infected bovine leukocyte. Protection against apoptosis involves constitutive activation of the bovine transcription factor NF-kappaB in a parasite-dependent manner. Activation of NF-kappaB is thought to involve recruitment of IKK signalosomes at the surface of the macroschizont stage of the parasite, and it has been postulated that additional host proteins with adaptor or scaffolding function may be involved in signalosome formation. In this study two clonal cell lines were identified that show marked differences in the level of activated NF-kappaB. Further characterization of these lines demonstrated that elevated levels of activated NF-kappaB correlated with increased resistance to cell death and detection of parasite-associated IKK signalosomes, supporting results of our previous studies. Evidence was also provided for the existence of host- and parasite-dependent NF-kappaB activation pathways that are influenced by the architecture of the actin cytoskeleton. Despite this influence, it appears that the primary event required for formation of the parasite-dependent IKK signalosome is likely to be an interaction between a signalosome component and a parasite-encoded surface ligand.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two competing models exist for the formation of the Pennsylvania salient, a widely studied area of pronounced curvature in the Appalachian mountain belt. The viability of these models can be tested by compiling and analyzing the patterns of structures within the general hinge zone of the Pennsylvania salient. One end-member model suggests a NW-directed maximum shortening direction and no rotation through time in the culmination. An alternative model requires a two-phase development of the culmination involving NNW-directed maximum shortening overprinted by WNW-directed maximum shortening. Structural analysis at 22 locations throughout the Valley and Ridge and southern Appalachian Plateau Provinces of Pennsylvania are used to constrain orientations of the maximum shortening direction and establish whether these orientations have rotated during progressive deformation in the Pennsylvania salient's hinge. Outcrops of Paleozoic sedimentary rocks contain several orders of folds, conjugate faults, steeply dipping strike-slip faults, joints, conjugate en echelon gash vein arrays, spaced cleavage, and grain-scale finite strain indicators. This suite of structures records a complex deformation history similar to the Bear Valley sequence of progressive deformation. The available structural data from the Juniata culmination do not show a consistent temporal rotation of shortening directions and generally indicate uniform,

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The tall epithelium of the developing chick embryo lung is converted to a squamous one, which participates in formation of the thin blood-gas barrier. We show that this conversion occurred through processes resembling exocrine secretion. Initially, cells formed intraluminal protrusions (aposomes), and then transcellular double membranes were established. Gaps between the membranes opened, thus, severing the aposome from the cell. Alternatively, aposomes were squeezed out by adjacent cells or were spontaneously constricted and extruded. As a third mechanism, formation and fusion of severed vesicles or vacuoles below the aposome and their fusion with the apicolateral plasma membrane resulted in severing of the aposome. The atria started to form by progressive epithelial attenuation and subsequent invasion of the surrounding mesenchyme at regions delineated by subepithelial alpha-smooth muscle actin-positive cells. Further epithelial attenuation was achieved by vacuolation; rupture of such vacuoles with resultant numerous microfolds and microvilli, which were abscised to accomplish a smooth squamous epithelium just before hatching.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A diesel oxidation catalyst (DOC) with a catalyzed diesel particulate filter (CPF) is an effective exhaust aftertreatment device that reduces particulate emissions from diesel engines, and properly designed DOC-CPF systems provide passive regeneration of the filter by the oxidation of PM via thermal and NO2/temperature-assisted means under various vehicle duty cycles. However, controlling the backpressure on engines caused by the addition of the CPF to the exhaust system requires a good understanding of the filtration and oxidation processes taking place inside the filter as the deposition and oxidation of solid particulate matter (PM) change as functions of loading time. In order to understand the solid PM loading characteristics in the CPF, an experimental and modeling study was conducted using emissions data measured from the exhaust of a John Deere 6.8 liter, turbocharged and after-cooled engine with a low-pressure loop EGR system and a DOC-CPF system (or a CCRT® - Catalyzed Continuously Regenerating Trap®, as named by Johnson Matthey) in the exhaust system. A series of experiments were conducted to evaluate the performance of the DOC-only, CPF-only and DOC-CPF configurations at two engine speeds (2200 and 1650 rpm) and various loads on the engine ranging from 5 to 100% of maximum torque at both speeds. Pressure drop across the DOC and CPF, mass deposited in the CPF at the end of loading, upstream and downstream gaseous and particulate emissions, and particle size distributions were measured at different times during the experiments to characterize the pressure drop and filtration efficiency of the DOCCPF system as functions of loading time. Pressure drop characteristics measured experimentally across the DOC-CPF system showed a distinct deep-bed filtration region characterized by a non-linear pressure drop rise, followed by a transition region, and then by a cake-filtration region with steadily increasing pressure drop with loading time at engine load cases with CPF inlet temperatures less than 325 °C. At the engine load cases with CPF inlet temperatures greater than 360 °C, the deep-bed filtration region had a steep rise in pressure drop followed by a decrease in pressure drop (due to wall PM oxidation) in the cake filtration region. Filtration efficiencies observed during PM cake filtration were greater than 90% in all engine load cases. Two computer models, i.e., the MTU 1-D DOC model and the MTU 1-D 2-layer CPF model were developed and/or improved from existing models as part of this research and calibrated using the data obtained from these experiments. The 1-D DOC model employs a three-way catalytic reaction scheme for CO, HC and NO oxidation, and is used to predict CO, HC, NO and NO2 concentrations downstream of the DOC. Calibration results from the 1-D DOC model to experimental data at 2200 and 1650 rpm are presented. The 1-D 2-layer CPF model uses a ‘2-filters in series approach’ for filtration, PM deposition and oxidation in the PM cake and substrate wall via thermal (O2) and NO2/temperature-assisted mechanisms, and production of NO2 as the exhaust gas mixture passes through the CPF catalyst washcoat. Calibration results from the 1-D 2-layer CPF model to experimental data at 2200 rpm are presented. Comparisons of filtration and oxidation behavior of the CPF at sample load-cases in both configurations are also presented. The input parameters and selected results are also compared with a similar research work with an earlier version of the CCRT®, to compare and explain differences in the fundamental behavior of the CCRT® used in these two research studies. An analysis of the results from the calibrated CPF model suggests that pressure drop across the CPF depends mainly on PM loading and oxidation in the substrate wall, and also that the substrate wall initiates PM filtration and helps in forming a PM cake layer on the wall. After formation of the PM cake layer of about 1-2 µm on the wall, the PM cake becomes the primary filter and performs 98-99% of PM filtration. In all load cases, most of PM mass deposited was in the PM cake layer, and PM oxidation in the PM cake layer accounted for 95-99% of total PM mass oxidized during loading. Overall PM oxidation efficiency of the DOC-CPF device increased with increasing CPF inlet temperatures and NO2 flow rates, and was higher in the CCRT® configuration compared to the CPF-only configuration due to higher CPF inlet NO2 concentrations. Filtration efficiencies greater than 90% were observed within 90-100 minutes of loading time (starting with a clean filter) in all load cases, due to the fact that the PM cake on the substrate wall forms a very efficient filter. A good strategy for maintaining high filtration efficiency and low pressure drop of the device while performing active regeneration would be to clean the PM cake filter partially (i.e., by retaining a cake layer of 1-2 µm thickness on the substrate wall) and to completely oxidize the PM deposited in the substrate wall. The data presented support this strategy.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The problem considered in this report is one of the mineralogy and mode of formation of the extremely pure, large bodies of vermiculite. Mineralogically the ultrabasic intrusive, with which the economic mineral is associated, presents an array of rather unusual minerals. The determination of these minerals, their associations, and the sequence of alteration that lead to the formation of the vermiculite bodies, constitutes the problem.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Glucocorticoids (GC) represent the most commonly used drugs for the treatment of acute and chronic inflammatory skin diseases. However, the topical long-term therapy of GC is limited by the occurrence of skin atrophy. Most interestingly, although GC inhibit proliferation of human fibroblasts, they exert a pronounced anti-apoptopic action. In the present study, we further elucidated the molecular mechanism of the GC dexamethasone (Dex) to protect human fibroblasts from programmed cell death. Dex not only significantly alters the expression of the cytosolic isoenzyme sphingosine kinase 1 but also initiated an enhanced intracellular formation of the sphingolipid sphingosine 1-phosphate (S1P). Investigations using S1P (3) ((-/-)) -fibroblasts revealed that this S1P-receptor subtype is essential for the Dex-induced cytoprotection. Moreover, we demonstrate that the ATP-binding cassette (ABC)-transporter ABCC1 is upregulated by Dex and may represent a crucial carrier to transport S1P from the cytosol to the S1P(3)-receptor subtype.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

PURPOSE: The unfolded protein response is triggered by the accumulation of misfolded proteins within the endoplasmic reticulum. Previous studies suggest that the unfolded protein response is activated in some cancer cell lines and involved in tumor development. The role of the unfolded protein response during leukemogenesis is unknown thus far. EXPERIMENTAL DESIGN: Here, we assessed the induction of key effectors of the unfolded protein response in leukemic cells at diagnosis of 105 acute myeloid leukemia (AML) patients comprising all subtypes. We determined the formation of the spliced variant of the X-box-binding protein 1 (XBP1) mRNA, as well as expression levels of calreticulin, GRP78, and CHOP mRNA. RESULTS: The formation of the spliced variant of XBP1s was detectable in 16.2% (17 of 105) of AML patients. Consistent with activated unfolded protein response, this group also had significantly increased expression of calreticulin, GRP78, and CHOP. AML patients with activated unfolded protein response had lower WBC counts, lactate dehydrogenase levels, and more frequently, secondary AML. The incidence of fms-related tyrosine kinase 3 (FLT3) mutations was significantly lower in patients with activated unfolded protein response. In addition, an association was observed between activated unfolded protein response and deletion of chromosome 7. Finally, the clinical course of AML patients with activated unfolded protein response was more favorable with lower relapse rate (P = 0.0182) and better overall (P = 0.041) and disease-free survival (P = 0.022). CONCLUSIONS: These results suggest that the unfolded protein response is activated in a considerable subset of AML patients. AML patients with activated unfolded protein response present specific clinical characteristics and a more favorable course of the disease.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Formation of the so far elusive chrysene excimer in solution is achieved by using DNA as a supramolecular scaffold. Oligonucleotides possessing one or two chrysene building blocks have been synthesized. Chrysene excimer fluorescence has been unambiguously observed in DNA double strands, as well as in single strands containing two neighbouring chrysenes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cells infected with MuSVts110 express a viral RNA which contains an inherent conditional defect in RNA splicing. It has been shown previously that splicing of the MuSVts110 primary transcript is essential to morphological transformation of 6m2 cells in vitro. A growth temperature of 33$\sp\circ$C is permissive for viral RNA splicing,and, consequently, 6m2 cells appear morphologically transformed at this temperature. However, 6m2 cells appear phenotypically normal when incubated at 39$\sp\circ$C, the non-permissive temperature for viral RNA splicing.^ After a shift from 39$\sp\circ$C to 33$\sp\circ$C, the coordinate splicing of previously synthesized and newly transcribed MuSVts110 RNA was achieved. By S1 nuclease analysis of total RNA isolated at various times, 5$\sp\prime$ splice site cleavage of the MuSVts110 transcript appeared to occur 60 minutes after the shift to 33$\sp\circ$C, and 30 minutes prior to detectable exon ligation. In addition, consistent with the permissive temperatures and the kinetic timeframe of viral RNA splicing after a shift to 33$\sp\circ$C, four temperature sensitive blockades to primer extension were identified 26-75 bases upstream of the 3$\sp\prime$ splice site. These blockades likely reflect four branchpoint sequences utilized in the formation of MuSVts110 lariat splicing-intermediates.^ The 54-5A4 cell line is a spontaneous revertant of 6m2 cells and appears transformed at all growth temperatures. Primer extension sequence analysis has shown that a five base deletion occurred at the 3$\sp\prime$ splice site in MuSVts110 RNA allowing the expression of a viral transforming protein in 54-5A4 in the absence of RNA splicing, whereas in the parental 6m2 cell line, a splicing event is necessary to generate a similar transforming protein. As a consequence of this deletion, splicing cannot occur and the formation of the four MuSVts110 branched-intermediates were not observed at any temperature in 54-5A4 cells. However, 5$\sp\prime$ splice site cleavage was still detected at 33$\sp\circ$C.^ Finally, we have investigated the role of the 1488 bp deletion which occurred in the generation of MuSVts110 in the activation of temperature sensitive viral RNA splicing. This deletion appears solely responsible for splice site activation. Whether intron size is the crucial factor in MuSVts110 RNA splicing or whether inhibitory sequences were removed by the deletion is currently unknown. (Abstract shortened with permission of author.) ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study reviews and synthesizes the present knowledge on the Sesia–Dent Blanche nappes, the highest tectonic elements in the Western Alps (Switzerland and Italy), which comprise pieces of pre-Alpine basement and Mesozoic cover. All of the available data are integrated in a crustal-scale kinematic model with the aim to reconstruct the Alpine tectono-metamorphic evolution of the Sesia–Dent Blanche nappes. Although major uncertainties remain in the pre-Alpine geometry, the basement and cover sequences of the Sesia–Dent Blanche nappes are seen as part of a thinned continental crust derived from the Adriatic margin. The earliest stages of the Alpine evolution are interpreted as recording late Cretaceous subduction of the Adria-derived Sesia–Dent Blanche nappes below the South-Alpine domain. During this subduction, several sheets of crustal material were stacked and separated by shear zones that rework remnants of their Mesozoic cover. The recently described Roisan-Cignana Shear Zone of the Dent Blanche Tectonic System represents such a shear zone, indicating that the Sesia–Dent Blanche nappes represent a stack of several individual nappes. During the subsequent subduction of the Piemonte–Liguria Ocean large-scale folding of the nappe stack (including the Roisan-Cignana Shear Zone) took place under greenschist facies conditions, which indicates partial exhumation of the Dent Blanche Tectonic System. The entrance of the Briançonnais micro-continent within the subduction zone led to a drastic change in the deformation pattern of the Alpine belt, with rapid exhumation of the eclogite-facies ophiolite bearing units and thrust propagation towards the foreland. Slab breakoff probably was responsible for allowing partial melting in the mantle and Oligocene intrusions into the most internal parts of the Sesia–Dent Blanche nappes. Finally, indentation of the Adriatic plate into the orogenic wedge resulted in the formation of the Vanzone back-fold, which marks the end of the pervasive ductile deformation within the Sesia–Dent Blanche nappes during the earliest Miocene.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The nail unit is the largest and a rather complex skin appendage. It is located on the dorsal aspect of the tips of fingers and toes and has important protective and sensory functions. Development begins in utero between weeks 7 and 8 and is fully formed at birth. For its correct development, a great number of signals are necessary. Anatomically, it consists of 4 epithelial components: the matrix that forms the nail plate; the nail bed that firmly attaches the plate to the distal phalanx; the hyponychium that forms a natural barrier at the physiological point of separation of the nail from the bed; and the eponychium that represents the undersurface of the proximal nail fold which is responsible for the formation of the cuticle. The connective tissue components of the matrix and nail bed dermis are located between the corresponding epithelia and the bone of the distal phalanx. Characteristics of the connective tissue include: a morphogenetic potency for the regeneration of their epithelia; the lateral and proximal nail folds form a distally open frame for the growing nail; and the tip of the digit has rich sensible and sensory innervation. The blood supply is provided by the paired volar and dorsal digital arteries. Veins and lymphatic vessels are less well defined. The microscopic anatomy varies from nail subregion to subregion. Several different biopsy techniques are available for the histopathological evaluation of nail alterations.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Formation of the FtsZ ring (Z ring) in Escherichia coli is the first step in assembly of the divisome, a molecular machine composed of 14 known proteins which are all required for cell division. Although the biochemical functions of most divisome proteins are unknown, several of these have overlapping roles in ensuring that the Z ring assembles at the cytoplasmic membrane and is active. ^ We identified a single amino acid change in FtsA, R286W, renamed FtsA*, that completely bypasses the requirement for ZipA in cell division. This and other data suggest that FtsA* is a hyperactive form of FtsA that can replace the multiple functions normally assumed by ZipA, which include stabilization of Z rings, recruitment of downstream cell division proteins, and anchoring the Z ring to the membrane. This is the first example of complete functional replacement of an essential prokaryotic cell division protein by another. ^ Cells expressing ftsA* with a complete deletion of ftsK are viable and divide, although many of these ftsK null cells formed multiseptate chains, suggesting a role in cell separation for FtsK. In addition, strains expressing extra ftsAZ, ftsQ, ftsB, zipA or ftsN, were also able to survive and divide in the absence of ftsK. The cytoplasmic and transmembrane domains of FtsQ were sufficient to allow viability and septum formation to ftsK deleted strains. These findings suggest that FtsK is normally involved in stabilizing the divisome and shares functional overlap with other cell division proteins. ^ As well as permitting the removal of other divisome components, the presence of FtsA* in otherwise wild-type cells accelerated Z-ring assembly, which resulted in a significant decrease in the average length of cells. In support of its role in Z-ring stability, FtsA* suppressed the cell division inhibition caused by overexpressing FtsZ. FtsA* did not affect FtsZ turnover within the Z ring as measured by fluorescence recovery after photobleaching. Turnover of FtsA* in the ring was somewhat faster than wild-type FtsA. Yeast two-hybrid data suggest that FtsA* has an increased affinity for FtsZ relative to wild-type FtsA. These results indicate that FtsA* interacts with FtsZ more strongly, and its enhancement of Z ring assembly may explain why FtsA* can permit survival of cells lacking ZipA or FtsK.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Regardless of genetic sex, amniotes develop two sets of genital ducts, the Wolffian and Müllerian ducts. Normal sexual development requires the differentiation of one duct and the regression of the other. I show that cells in the rostral most region of the coelomic epithelium (CE) are specified to a Müllerian duct fate beginning at Tail Somite Stage 19 (TS19). The Müllerian duct (MD) invaginates from the CE where it extends caudally to and reaches the Wolffian duct (WD) by TS22. Upon contact, the MD elongates to the urogenital sinus separating the WD from the CE and its formation is complete by TS34. During its elongation, the MD is associated with and dependent upon the WD and I have identified the mechanism for MD elongation. Using the Rosa26 reporter to fate map the WD, I show that the WD does not contribute cells to the MD. Using an in vitro recombinant explant culture assay I show that the entire length of the MD is derived from the CE. Furthermore, I analyzed cell proliferation and developed an in vitro assay to show that a small population of cells at the caudal tip proliferates, laying the foundation for the formation of the MD. I also show that during its formation, the MD has a distinctive mesoepithelial character. The MD in males regresses under the influence of Anti-Müllerian Hormone (AMH). Through tissue-specific gene inactivation I have identified that Acvr1 and Bmpr1a and Smad1, Smad5 and Smad8 function redundantly in transducing the AMH signal. In females the MD differentiates into an epithelial tube and eventually the female reproductive tract. However, the exact tissue into which the MD differentiates has not been determined. I therefore generated a MD specific Cre allele that will allow for the fate mapping of the MD in both females males. The MD utilizes a unique form of tubulogenesis during development and to my knowledge is the only tubule that relies upon a signal from and the presence of another distinct epithelial tube for its formation.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Ion channels play a crucial role in the functioning of different systems of the body because of their ability to bridge the cell membrane and allow ions to pass in and out of the cell. Ionotropic glutamate receptors are one class of these important proteins and have been shown to be critical in propagating synaptic transmission in the central nervous system and in other diverse functions throughout the body. Because of their wide-ranging effects, this family of receptors is an important target for structure-function investigations to understand their mechanism of action. ^ α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors are one subtype of glutamate receptors and have been shown to be the primary receptors involved in rapid excitatory signaling in the central nervous system. Agonist binding to the extracellular ligand binding domain of these receptors causes various conformational changes that culminate in formation of the ion channel. Previous structural investigations have provided important information about their mechanism of action, including uncovering a relationship between the degree of cleft closure in the binding domain and activation of the receptor. However, what question remains unanswered is how specific interactions between the agonist and the protein interplay with cleft closure to mediate receptor activation. ^ To investigate this question, I applied a multiscale approach to investigate the effects of agonist binding on various levels. Vibrational spectroscopy was utilized to investigate molecular-level interactions in the binding pocket, and fluorescence resonance energy transfer (FRET) was employed to measure cleft closure in the isolated ligand binding domain. The results of these studies in the isolated binding domain were then correlated to activation of the full receptor. These investigations showed a relationship between the strength of the interaction at the α-amine group of the agonist and extent of receptor activation, where a stronger interaction correlated to a larger activation, which was upheld even when the extent of cleft closure did not correlate to activation. These results show that this interaction at the α-amine group is critical in mediating the allosteric mechanism of activation and provide a bit more insight into how agonist binding is coupled to channel gating in AMPA receptors. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^