896 resultados para Barrier islands.


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The application of VSC-HVDC technology throughout the world has turned out to be an efficient solution regarding a large share of wind power in different power systems. This technology enhances the overall reliability of the grid by utilization of the active and reactive power control schemes which allows to maintain frequency and voltage on busbars of the end-consumers at the required level stated by the network operator. This master’s thesis is focused on the existing and planned wind farms as well as electric power system of the Åland Islands. The goal is to analyze the wind conditions of the islands and appropriately predict a possible production of the existing and planned wind farms with a help of WAsP software program. Further, to investigate the influence of increased wind power it is necessary to develop a simulation model of the electric grid and VSC-HVDC system in PSCAD and examine grid response to different wind power production cases with respect to the grid code requirements and ensure the stability of the power system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this study was to verify and compare the main contamination sources and the hygienic/sanitary conditions of organic honey samples of Apis mellifera from Parana River islands. Thirty-three (33) samples were analyzed between January 2005 and August 2006. Eleven (11) samples were collected by beekeepers and twenty-two (22) samples were collected and processed in accordance with ideal personal hygiene norms and good manufacturing practices. The samples underwent microbiological analysis in search of coliforms at 35 ºC and 45 ºC, as well as fungi enumeration analysis. As for fungi counting, the samples harvested by beekeepers showed values above the maximum established by Resolution nº 15/94 of Common Market Group - Mercosul. The results showed that secondary contamination sources are responsible for the reduction of organic honey quality.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This research was carried out to evaluate the physicochemical composition of organic honey in Paraná River islands, in Porto Brasílio, State of Paraná. Honey was harvested directly from super of the colonies in three apiaries spread in the Floresta and Laranjeira Islands, from August 2005 to August 2006. Twenty-four samples of organic honey produced by Africanized honeybees were evaluated. The following parameters were analyzed: pH, acidity, formol index, hydroxymethylfurfural, ashes, color, electric conductivity and moisture. Three replications per sample were performed for laboratorial analysis, giving the means and standard deviation. Most honey samples were in conformity with the Normative Instruction 11 from October 20, 2000. However, 4.17% were not in accordance with the moisture standards, 8.33% showed high concentrations of hydroxymethylfurfural, thus, totalizing 12.50% of non-complying samples. Nevertheless, 87.50% of the analyzed honey samples are within the standards, being characterized as an organic product of excellent quality, with good commercialization perspectives in the market.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Finnish Defence Studies is published under the auspices of the National Defence College, and the contributions reflect the fields of research and teaching of the College. Finnish Defence Studies will occasionally feature documentation on Finnish Security Policy. Views expressed are those of the authors and do not necessarily imply endorsement by the National Defence College.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Falkland Islands War of 1982 was fought over competing claims to sovereignty over a group of islands off the east coast of South America. The dispute was between Argentina and the United Kingdom. Argentina claims the islands under rights to Spanish succession, the fact that they lie off the Argentine coast line and that in 1833 Great Britain took the islands illegally and by force. The United Kingdom claims the islands primarily through prescription--the fact that they have governed the islands in a peaceful, continuous and public manner since 1833. The British also hold that the population living on the islands, roughly eighteen hundred British descendants, should be able to decide their own future. The United Kingdom also lays claim to the islands through rights of discovery and settlement, although this claim has always been challenged by Spain who until 1811 governed the islands. Both claims have legal support, and the final decision if there will ever be one is difficult to predict. Sadly today the ultimate test of sovereignty does not come through international law but remains in the idea that "He is sovereign who can defend his sovereignty." The years preceding the Argentine invasion of 1982 witnessed many diplomatic exchanges between The United Kingdom and Argentina over the future of the islands. During this time the British sent signals to Argentina that ii implied a decline in British resolve to hold the islands and demonstrated that military action did more to further the talks along than did actual negotiations. The Argentine military junta read these signals and decided that they could take the islands in a quick military invasion and that the United Kingdom would consider the act as a fait accompli and would not protest the invasion. The British in response to this claimed that they never signaled to Argentina that a military solution was acceptable to them and launched a Royal Navy task force to liberate the islands. Both governments responded to an international crisis with means that were designed both to resolve the international crisis and increase the domestic popularity of the government. British Prime Minister Margaret Thatcher was facing an all-time low in popularity for post-War Prime Ministers while Argentine President General Galtieri needed to gain mass popular support so he could remain a viable President after he was scheduled to lose command of the army and a seat on the military junta that ran the country. The military war for the Falklands is indicative of the nature of modern warfare between Third World countries. It shows that the gap in military capabilities between Third and First World countries is narrowing significantly. Modern warfare between a First and Third World country is no longer a 'walk over' for the First World country.