Sequence of reactions leading to cytochrome-p-450 synthesis-effect of drugs

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Sequence distribution in Acrylonitrile-methylacrylate random copolymers by N.M.R spectroscopy

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Immunological studies on nucleic-acids and their components .5. Antibodies specific to a deoxyribodinucleotide sequence

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Genomic approach to organ-specific growth control

Growth is a fundamental aspect of life cycle of all organisms. Body size varies highly in most animal groups, such as mammals. Moreover, growth of a multicellular organism is not uniform enlargement of size, but different body parts and organs grow to their characteristic sizes at different times. Currently very little is known about the molecular mechanisms governing this organ-specific growth. The genome sequencing projects have provided complete genomic DNA sequences of several species over the past decade. The amount of genomic sequence information, including sequence variants within species, is constantly increasing. Based on the universal genetic code, we can make sense of this sequence information as far as it codes proteins. However, less is known about the molecular mechanisms that control expression of genes, and about the variations in gene expression that underlie many pathological states in humans. This is caused in part by lack of information about the second genetic code that consists of the binding specificities of transcription factors and the combinatorial code by which transcription factor binding sites are assembled to form tissue-specific and/or ligand-regulated enhancer elements. This thesis presents a high-throughput assay for identification of transcription factor binding specificities, which were then used to measure the DNA binding profiles of transcription factors involved in growth control. We developed ‘enhancer element locator’, a computational tool, which can be used to predict functional enhancer elements. A genome-wide prediction of human and mouse enhancer elements generated a large database of enhancer elements. This database can be used to identify target genes of signaling pathways, and to predict activated transcription factors based on changes in gene expression. Predictions validated in transgenic mouse embryos revealed the presence of multiple tissue-specific enhancers in mouse c- and N-Myc genes, which has implications to organ specific growth control and tumor type specificity of oncogenes. Furthermore, we were able to locate a variation in a single nucleotide, which carries a susceptibility to colorectal cancer, to an enhancer element and propose a mechanism by which this SNP might be involved in generation of colorectal cancer.

Tributyltin chloride-sodium cyanoborohydride mediated tandem radical cyclisation-reductive demethoxylation sequence

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Characterization of sequence and structural features of the Candida krusei Enolase

The incidence of human infections by the fungal pathogen Candida species has been increasing in recent years. Enolase is an essential protein in fungal metabolism. Sequence data is available for human and a number of medically important fungal species. An understanding of the structural and functional features of fungal enolases may provide the structural basis for their use as a target for the development of new anti-fungal drugs. We have obtained the sequence of the enolase of Candida krusei (C. krusei), as it is a significant medically important fungal pathogen. We have then used multiple sequence alignments with various enolase isoforms in order to identify C. krusei specific amino acid residues. The phylogenetic tree of enolases shows that the C. krusei enolase assembles on the tree with the fungal genes. Importantly, C. krusei lacks four amino acids in the active site compared to human enolase, as revealed by multiple sequence alignments. These differences in the substrate binding site may be exploited for the design of new anti-fungal drugs to selectively block this enzyme. The lack of the important amino acids in the active site also indicates that C. krusei enolase might have evolved as a member of a mechanistically diverse enolase superfamily catalying somewhat different reactions.

A common epitope of beta-lactoglobulin and serum retinol-binding proteins: Elucidation of its core sequence using synthetic peptides

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Comparative sequence analysis and expression in E-coli of the subgroup I-specific antigen VP6 from a G2 serotype human rotavirus IS2

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Draft genome sequence of caloramator mitchellensis, a thermoanaerobe isolated from the waters of the Great Artesian Basin

The genome sequence of Caloramator mitchellensis strain VF08, a rod-shaped, heterotrophic, strictly anaerobic bacterium iso-lated from the free-flowing waters of a Great Artesian Basin (GAB) bore well located in Mitchell, an outback Queensland town in Australia, is reported here. The analysis of the 2.42-Mb genome sequence indicates that the attributes of the genome are consistent with its physiological and phenotypic traits.

Applications of gene sequence polymorphisms in evolutionary genetic studies of Atlantic salmon (Salmo salar) and other teleost fish species

Evolutionary genetics incorporates traditional population genetics and studies of the origins of genetic variation by mutation and recombination, and the molecular evolution of genomes. Among the primary forces that have potential to affect the genetic variation within and among populations, including those that may lead to adaptation and speciation, are genetic drift, gene flow, mutations and natural selection. The main challenges in knowing the genetic basis of evolutionary changes is to distinguish the adaptive selection forces that cause existent DNA sequence variants and also to identify the nucleotide differences responsible for the observed phenotypic variation. To understand the effects of various forces, interpretation of gene sequence variation has been the principal basis of many evolutionary genetic studies. The main aim of this thesis was to assess different forms of teleost gene sequence polymorphisms in evolutionary genetic studies of Atlantic salmon (Salmo salar) and other species. Firstly, the level of Darwinian adaptive evolution affected coding regions of the growth hormone (GH) gene during the teleost evolution was investigated based on the sequence data existing in public databases. Secondly, a target gene approach was used to identify within population variation in the growth hormone 1 (GH1) gene in salmon. Then, a new strategy for single nucleotide polymorphisms (SNPs) discovery in salmonid fishes was introduced, and, finally, the usefulness of a limited number of SNP markers as molecular tools in several applications of population genetics in Atlantic salmon was assessed. This thesis showed that the gene sequences in databases can be utilized to perform comparative studies of molecular evolution, and some putative evidence of the existence of Darwinian selection during the teleost GH evolution was presented. In addition, existent sequence data was exploited to investigate GH1 gene variation within Atlantic salmon populations throughout its range. Purifying selection is suggested to be the predominant evolutionary force controlling the genetic variation of this gene in salmon, and some support for gene flow between continents was also observed. The novel approach to SNP discovery in species with duplicated genome fragments introduced here proved to be an effective method, and this may have several applications in evolutionary genetics with different species - e.g. when developing gene-targeted markers to investigate quantitative genetic variation. The thesis also demonstrated that only a few SNPs performed highly similar signals in some of the population genetic analyses when compared with the microsatellite markers. This may have useful applications when estimating genetic diversity in genes having a potential role in ecological and conservation issues, or when using hard biological samples in genetic studies as SNPs can be applied with relatively highly degraded DNA.

Plasmids and aromatic degradation in Sphingomonas for bioremediation : Aromatic ring cleavage genes in soil and rhizosphere

Microbial degradation pathways play a key role in the detoxification and the mineralization of polyaromatic hydrocarbons (PAHs), which are widespread pollutants in soil and constituents of petroleum hydrocarbons. In microbiology the aromatic degradation pathways are traditionally studied from single bacterial strains with capacity to degrade certain pollutant. In soil the degradation of aromatics is performed by a diverse community of micro-organisms. The aim of this thesis was to study biodegradation on different levels starting from a versatile aromatic degrader Sphingobium sp. HV3 and its megaplasmid, extending to revelation of diversity of key catabolic enzymes in the environment and finally studying birch rhizoremediation in PAH-polluted soil. To understand biodegradation of aromatics on bacterial species level, the aromatic degradation capacity of Sphingobium sp. HV3 and the role of the plasmid pSKY4, was studied. Toluene, m-xylene, biphenyl, fluorene, phenanthrene were detected as carbon and energy sources of the HV3 strain. Tn5 transposon mutagenesis linked the degradation capacity of toluene, m-xylene, biphenyl and naphthalene to the pSKY4 plasmid and qPCR expression analysis showed that plasmid extradiol dioxygenases genes (bphC and xylE) are inducted by phenanthrene, m-xylene and biphenyl whereas the 2,4-dichlorophenoxyacetic acid herbicide induced the chlorocatechol 1,2-dioxygenase gene (tfdC) from the ortho-pathway. A method to study upper meta-pathway extradiol dioxygenase gene diversity in soil was developed. The extradiol dioxygenases catalyse cleavage of the aromatic ring between a hydroxylated carbon and an adjacent non-hydroxylated carbon (meta-cleavage). A high diversity of extradiol dioxygenases were detected from polluted soils. The detected extradiol dioxygenases showed sequence similarity to known catabolic genes of Alpha-, Beta-, and Gammaproteobacteria. Five groups of extradiol dioxygenases contained sequences with no close homologues in the database, representing novel genes. In rhizoremediation experiment with birch (Betula pendula) treatment specific changes of extradiol dioxygenase communities were shown. PAH pollution changed the bulk soil extradiol dioxygenase community structure and birch rhizosphere contained a more diverse extradiol dioxygenase community than the bulk soil showing a rhizosphere effect. The degradation of pyrene in soil was enhanced with birch seedlings compared to soil without birch. The complete 280,923 kb nucleotide sequence of pSKY4 plasmid was determined. The open reading frames of pSKY4 were divided into putative conjugative transfer, aromatic degradation, replication/maintaining and transposition/integration function-encoding proteins. Aromatic degradation orfs shared high similarity to corresponding genes in pNL1, a plasmid from the deep subsurface strain Novosphingobium aromaticivorans F199. The plasmid backbones were considerably more divergent with lower similarity, which suggests that the aromatic pathway has functioned as a plasmid independent mobile genetic element. The functional diversity of microbial communities in soil is still largely unknown. Several novel clusters of extradiol dioxygenases representing catabolic bacteria, whose function, biodegradation pathways and phylogenetic position is not known were amplified with single primer pair from polluted soils. These extradiol dioxygenase communities were shown to change upon PAH pollution, which indicates that their hosts function in PAH biodegradation in soil. Although the degradation pathways of specific bacterial species are substantially better depicted than pathways in situ, the evolution of degradation pathways for the xenobiotic compounds is largely unknown. The pSKY4 plasmid contains aromatic degradation genes in putative mobile genetic element causing flexibility/instability to the pathway. The localisation of the aromatic biodegradation pathway in mobile genetic elements suggests that gene transfer and rearrangements are a competetive advantage for Sphingomonas bacteria in the environment.