Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Minimal DNA sequences that control the cell lineage-specific expression of the pro$\alpha$2(I) collagen promoter in transgenic mice

The pattern of expression of the pro$\alpha$2(I) collagen gene is highly tissue-specific in adult mice and shows its strongest expression in bones, tendons, and skin. Transgenic mice were generated harboring promoter fragments of the mouse pro$\alpha$2(I) collagen gene linked to the Escherichia coli $\beta$-galactosidase or firefly luciferase genes to examine the activity of these promoters during development. A region of the mouse pro$\alpha$2(I) collagen promoter between $-$2000 and +54 exhibited a pattern of $\beta$-galactosidase activity during embryonic development that corresponded to the expression pattern of the endogenous pro$\alpha$2(I) collagen gene as determined by in situ hybridization. A similar pattern of activity was also observed with much smaller promoter fragments containing either 500 or 350 bp of upstream sequence relative to the start of transcription. Embryonic regions expressing high levels of $\beta$-galactosidase activity included the valves of the developing heart, sclerotomes, meninges, limb buds, connective tissue fascia between muscle fibers, osteoblasts, tendon, periosteum, dermis, and peritoneal membranes. The pattern of $\beta$-galactosidase activity was similar to the extracellular immunohistochemical localization of transforming growth factor-$\beta$1 (TGF-$\beta$1). The $-$315 to $-$284 region of the pro$\alpha$2(I) collagen promoter was previously shown to mediate the stimulatory effects of TGF-$\beta$1 on the pro$\alpha$2(I) collagen promoter in DNA transfection experiments with cultured fibroblasts. A construct containing this sequence tandemly repeated 5$\sp\prime$ to both a very short $\alpha$2(I) collagen promoter ($-$40 to +54) and a heterologous minimal promoter showed preferential activity in tail and skin of 4-week old transgenic mice. The pattern of expression mimics that of the $-$350 to +54 pro$\alpha$2(I) collagen promoter linked to a luciferase reporter gene in transgenic mice. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Characterization of the cholesterol 7$\alpha$-hydroxylase promoter in hypercholesterolemia -resistant rabbits

Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^

A distinct element involved in the lipopolysaccharide activation of the tumor necrosis factor -alpha promoter in a promonocytic cell line, THP-1

TNF-α is a pleiotropic cytokine involved in normal homeostasis and plays a key role in defending the host from infection and malignancy. However when deregulated, TNF-α can lead to various disease states. Therefore, understanding the mechanisms by which TNF-α is regulated may aid in its control. In spite of the knowledge gained regarding the transcriptional regulation of TNF-α further characterization of specific TNF-α promoter elements remains to be elucidated. In particular, the T&barbelow;NF-α A&barbelow;P-1/C&barbelow;RE-like (TAC) element of the TNF-α promoter has been shown to be important in the regulation of TNF-α in lymphocytes. Activating transcription factor-2 (ATF-2) and c-Jun were shown to bind to and transactivate the TAC element However, the role of TAC and transcription factors ATF-2 and c-Jun in the regulation of TNF-α in monocytes is not as well characterized. Lipopolysaccharide (LPS), a potent activator of TNF-α in monocytes, provides a good model to study the involvement of TAC in TNF-α regulation. On the other hand, all-tram retinoic acid (ATRA), a physiological monocyte-differentiation agent, is unable to induce TNF-α protein release. ^ To delineate the functional role of TAC, we transfected the wildtype or the TAC deleted TNF-α promoter-CAT construct into THP-1 promonocytic cells before stimulating them with LPS. CAT activity was induced 17-fold with the wildtype TNF-α promoter, whereas the CAT activity was uninducible when the TAC deletion mutant was used. This daft suggests that TAC is vital for LPS to activate the TNF-α promoter. Electrophoretic mobility shift assays using the TAC element as a probe showed a unique pattern for LPS-activated cells: the disappearance of the upper band of a doublet seen in untreated and ATRA treated cells. Supershift analysis identified c-Jun and ATF-2 as components of the LPS-stimulated binding complex. Transient transfection studies using dominant negative mutants of JNK, c-Jun, or ATF-2 suggest that these proteins we important for LPS to activate the TNF-α promoter. Furthermore, an increase in phosphorylated or activated c-Jun was bound to the TAC element in LPS-stimulated cells. Increased c-Jun activation was correlated with increased activity of Jun N-terminal kinase (JNK), a known upstream stimulator of c-Jun and ATF-2, in LPS-stimulated monocytes. On the other hand, ATRA did not induce TNF-α protein release nor changes in the phosphorylation of c-Jun or JNK activity, suggesting that pathways leading to ATRA differentiation of monocytic cells are independent of TNF-α activation. Together, the induction of TNF-α gene expression seems to require JNK activation, and activated c-Jun binding to the TAC element of the TNF-α promoter in THP-1 promonocytic cells. ^

Dopamine receptor 4 promoter polymorphism modulates memory and neuronal responses to salience

Animal models and human functional imaging data implicate the dopamine system in mediating enhanced encoding of novel stimuli into human memory. A separate line of investigation suggests an association between a functional polymorphism in the promoter region for the human dopamine 4 receptor gene (DRD4) and sensitivity to novelty. We demonstrate, in two independent samples, that the -521Cmayor queT DRD4 promoter polymorphism determines the magnitude of human memory enhancement for contextually novel, perceptual oddball stimuli in an allele dose-dependent manner. The genotype-dependent memory enhancement conferred by the C allele is associated with increased neuronal responses during successful encoding of perceptual oddballs in the ventral striatum, an effect which is again allele dose-dependent. Furthermore, with repeated presentations of oddball stimuli, this memory advantage decreases, an effect mirrored by adaptation of activation in the hippocampus and substantia nigra/ventral tegmental area in C carriers only. Thus, a dynamic modulation of human memory enhancement for perceptually salient stimuli is associated with activation of a dopaminergic-hippocampal system, which is critically dependent on a functional polymorphism in the DRD4 promoter region.

Ubiquitin-dependent degradation of IκBα is mediated by a ubiquitin ligase Skp1/Cul 1/F-box protein FWD1

Activation of the transcription factor nuclear factor kappa B (NF-κB) is controlled by proteolysis of its inhibitory subunit (IκB) via the ubiquitin-proteasome pathway. Signal-induced phosphorylation of IκBα by a large multisubunit complex containing IκB kinases is a prerequisite for ubiquitination. Here, we show that FWD1 (a mouse homologue of Slimb/βTrCP), a member of the F-box/WD40-repeat proteins, is associated specifically with IκBα only when IκBα is phosphorylated. The introduction of FWD1 into cells significantly promotes ubiquitination and degradation of IκBα in concert with IκB kinases, resulting in nuclear translocation of NF-κB. In addition, FWD1 strikingly evoked the ubiquitination of IκBα in the in vitro system. In contrast, a dominant-negative form of FWD1 inhibits the ubiquitination, leading to stabilization of IκBα. These results suggest that the substrate-specific degradation of IκBα is mediated by a Skp1/Cull 1/F-box protein (SCF) FWD1 ubiquitin-ligase complex and that FWD1 serves as an intracellular receptor for phosphorylated IκBα. Skp1/Cullin/F-box protein FWD1 might play a critical role in transcriptional regulation of NF-κB through control of IκB protein stability.

Regulation of the human p21/WAF1/Cip1 promoter in hepatic cells by functional interactions between Sp1 and Smad family members

The cell cycle inhibitor p21/WAF1/Cip1 is expressed in many cell types and is regulated by p53-dependent and p53-independent mechanisms. p21 is an important regulator of hepatocyte cell cycle, differentiation, and liver development, but little is known about the regulation of its synthesis in hepatocytes. We report herein that the p21 gene is constitutively expressed in human hepatoma HepG2 cells. Deletion analysis of the p21 promoter showed that it contains a distal (positions −2,300/−210) and a proximal (positions −124 to −61) region that act synergistically to achieve high levels of constitutive expression. The proximal region that consists of multiple Sp1 binding sites is essential for constitutive p21 promoter activity in hepatocytes. This region also mediates the transcriptional activation of the p21 promoter by members of the Smad family of proteins, which play important role in the transduction of extracellular signals such as transforming growth factor β, activin, etc. Constitutive expression of p21 was severely reduced by a C-terminally truncated form of Smad4 that was shown previously to block signaling through Smads. Smad3/4 and to a much lesser extent Smad2/4 caused high levels of transcriptional activation of the p21 promoter. Transactivation was compromised by N- or C-terminally truncated forms of Smad3. By using Gal4-Sp1 fusion proteins, we show that Smad proteins can activate gene transcription via functional interactions with the ubiquitous factor Sp1. These data demonstrate that Smad proteins and Sp1 participate in the constitutive or inducible expression of the p21 gene in hepatic cells.

Human CUL1 forms an evolutionarily conserved ubiquitin ligase complex (SCF) with SKP1 and an F-box protein

The SCF ubiquitin ligase complex of budding yeast triggers DNA replication by catalyzing ubiquitination of the S phase cyclin-dependent kinase inhibitor SIC1. SCF is composed of three proteins—ySKP1, CDC53 (Cullin), and the F-box protein CDC4—that are conserved from yeast to humans. As part of an effort to identify components and substrates of a putative human SCF complex, we isolated hSKP1 in a two-hybrid screen with hCUL1, the closest human homologue of CDC53. Here, we show that hCUL1 associates with hSKP1 in vivo and directly interacts with both hSKP1 and the human F-box protein SKP2 in vitro, forming an SCF-like particle. Moreover, hCUL1 complements the growth defect of yeast cdc53ts mutants, associates with ubiquitination-promoting activity in human cell extracts, and can assemble into functional, chimeric ubiquitin ligase complexes with yeast SCF components. Taken together, these data suggest that hCUL1 functions as part of an SCF ubiquitin ligase complex in human cells. Further application of biochemical assays similar to those described here can now be used to identify regulators/components of hCUL1-based SCF complexes, to determine whether the hCUL2–hCUL5 proteins also are components of ubiquitin ligase complexes in human cells, and to screen for chemical compounds that modulate the activities of the hSKP1 and hCUL1 proteins.

Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma

Inactivation of the genes involved in DNA mismatch repair is associated with microsatellite instability (MSI) in colorectal cancer. We report that hypermethylation of the 5′ CpG island of hMLH1 is found in the majority of sporadic primary colorectal cancers with MSI, and that this methylation was often, but not invariably, associated with loss of hMLH1 protein expression. Such methylation also occurred, but was less common, in MSI− tumors, as well as in MSI+ tumors with known mutations of a mismatch repair gene (MMR). No hypermethylation of hMSH2 was found. Hypermethylation of colorectal cancer cell lines with MSI also was frequently observed, and in such cases, reversal of the methylation with 5-aza-2′-deoxycytidine not only resulted in reexpression of hMLH1 protein, but also in restoration of the MMR capacity in MMR-deficient cell lines. Our results suggest that microsatellite instability in sporadic colorectal cancer often results from epigenetic inactivation of hMLH1 in association with DNA methylation.

Identification of thyroid hormone response elements in the human fatty acid synthase promoter

To investigate the regulation of the human fatty acid synthase gene by the thyroid hormone triiodothyronine, various constructs of the human fatty acid synthase promoter and the luciferase reporter gene were transfected in combination with plasmids expressing the thyroid hormone and the retinoid X receptors in HepG2 cells. The reporter gene was activated 25-fold by the thyroid hormone in the presence of the thyroid hormone receptor. When both the thyroid hormone and the retinoid X receptors were expressed in HepG2 cells, there was about a 100-fold increase in reporter gene expression. 5′-Deletion analysis disclosed two thyroid hormone response elements, TRE1 (nucleotides −870 to −650) and TRE2 (nucleotides −272 to −40), in the human fatty acid synthase promoter. The presence of thyroid hormone response elements in these two regions of the promoter was confirmed by cloning various fragments of these two regions in the minimal thymidine kinase promoter−luciferase reporter gene plasmid construct and determining reporter gene expression. The results of this cloning procedure and those of electrophoretic mobility shift assays indicated that the sequence GGGTTAcgtcCGGTCA (nucleotides −716 to −731) represents TRE1 and that the sequence GGGTCC (nucleotides −117 to −112) represents TRE2. The sequence of TRE1 is very similar to the consensus sequence of the thyroid hormone response element, whereas the sequence of TRE2 contains only a half-site of the thyroid hormone response element consensus motif because it lacks the direct repeat. The sequences on either side of TRE2 seem to influence its response to the thyroid hormone and retinoid X receptors.

Rates of ubiquitin conjugation increase when muscles atrophy, largely through activation of the N-end rule pathway

The rapid loss of muscle mass that accompanies many disease states, such as cancer or sepsis, is primarily a result of increased protein breakdown in muscle, and several observations have suggested an activation of the ubiquitin–proteasome system. Accordingly, in extracts of atrophying muscles from tumor-bearing or septic rats, rates of 125I-ubiquitin conjugation to endogenous proteins were found to be higher than in control extracts. On the other hand, in extracts of muscles from hypothyroid rats, where overall proteolysis is reduced below normal, the conjugation of 125I-ubiquitin to soluble proteins decreased by 50%, and treatment with triiodothyronine (T3) restored ubiquitination to control levels. Surprisingly, the N-end rule pathway, which selectively degrades proteins with basic or large hydrophobic N-terminal residues, was found to be responsible for most of these changes in ubiquitin conjugation. Competitive inhibitors of this pathway that specifically block the ubiquitin ligase, E3α, suppressed most of the increased ubiquitin conjugation in the muscle extracts from tumor-bearing and septic rats. These inhibitors also suppressed ubiquitination in normal extracts toward levels in hypothyroid extracts, which showed little E3α-dependent ubiquitination. Thus, the inhibitors eliminated most of the differences in ubiquitination under these different pathological conditions. Moreover, 125I-lysozyme, a model N-end rule substrate, was ubiquitinated more rapidly in extracts from tumor-bearing and septic rats, and more slowly in those from hypothyroid rats, than in controls. Thus, the rate of ubiquitin conjugation increases in atrophying muscles, and these hormone- and cytokine-dependent responses are in large part due to activation of the N-end rule pathway.

Targeting a SWI/SNF-related chromatin remodeling complex to the β-globin promoter in erythroid cells

Chromatin remodeling complexes such as the SWI/SNF complex make DNA accessible to transcription factors by disrupting nucleosomes. However, it is not known how such complexes are targeted to the promoter. For example, a SWI/SNF1-like chromatin remodeling complex erythroid Krüppel-like factor (EKLF) coactivator-remodeling complex 1 (E-RC1) disrupts the nucleosomes over the human β-globin promoter in an EKLF-dependent manner. However, it is not known whether E-RC1 is targeted specifically to the β-globin promoter or whether E-RC1 is randomly targeted, but its activity is evident only at the β-globin promoter. Because E-RC1 cannot remodel chromatin over the β-globin promoter without EKLF in vitro, it has been proposed that SWI/SNF1-like complexes such as E-RC1 are targeted specifically to the promoter by selectively interacting with promoter-associated transcription factors such as EKLF. In this report, we test this hypothesis in the cellular context by using the ProteIN POsition Identification with Nuclease Tail (PIN*POINT) assay. We find that the Brahma-related gene (BRG) 1 and BRG1-associated factor (BAF) 170 subunits of E-RC1 are both recruited near the transcription initiation site of the β-globin promoter. On transiently transfected templates, both the locus control region and the EKLF-binding site are important for their recruitment to the β-globin promoter in mouse erythroleukemia cells. When the β-globin promoter was linked to the cytomegalovirus enhancer, the E-RC1 complex was not recruited, suggesting that recruitment of the E-RC1 complex is not a general property of enhancers.

Covalent modification of the homeodomain-interacting protein kinase 2 (HIPK2) by the ubiquitin-like protein SUMO-1

Posttranslational modifications such as ubiquitination and phosphorylation play an important role in the regulation of cellular protein function. Homeodomain-interacting protein kinase 2 (HIPK2) is a member of the recently identified family of nuclear protein kinases that act as corepressors for homeodomain transcription factors. Here, we show that HIPK2 is regulated by a ubiquitin-like protein, SUMO-1. We demonstrate that HIPK2 localizes to nuclear speckles (dots) by means of a speckle-retention signal. This speckle-retention signal contains a domain that interacts with a mouse ubiquitin-like protein conjugating (E2) enzyme, mUBC9. In cultured cells, HIPK2 is covalently modified by SUMO-1, and the SUMO-1 modification of HIPK2 correlates with its localization to nuclear speckles (dots). Thus, our results provide firm evidence that the nuclear protein kinase HIPK2 can be covalently modified by SUMO-1, which directs its localization to nuclear speckles (dots).

In Azotobacter vinelandii, the E1 subunit of the pyruvate dehydrogenase complex binds fpr promoter region DNA and ferredoxin I

In Azotobacter vinelandii, deletion of the fdxA gene that encodes a well characterized seven-iron ferredoxin (FdI) is known to lead to overexpression of the FdI redox partner, NADPH:ferredoxin reductase (FPR). Previous studies have established that this is an oxidative stress response in which the fpr gene is transcriptionally activated to the same extent in response to either addition of the superoxide propagator paraquat to the cells or to fdxA deletion. In both cases, the activation occurs through a specific DNA sequence located upstream of the fpr gene. Here, we report the identification of the A. vinelandii protein that binds specifically to the paraquat activatable fpr promoter region as the E1 subunit of the pyruvate dehydrogenase complex (PDHE1), a central enzyme in aerobic respiration. Sequence analysis shows that PDHE1, which was not previously suspected to be a DNA-binding protein, has a helix–turn–helix motif. The data presented here further show that FdI binds specifically to the DNA-bound PDHE1.