963 resultados para Starlike Function of Order Alpha


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to evaluate the effect of metabolic syndrome (MetS) and its individual components on the renal function of patients with type 2 diabetes mellitus (DM). A cross-sectional study was performed in 842 type 2 DM patients. A clinical and laboratory evaluation, including estimated glomerular filtration rate (eGFR) calculated by the modification of diet in renal disease formula, was performed. MetS was defined according to National Cholesterol Education Program - Adult Treatment Panel III criteria. Mean patient age was 57.9 ± 10.1 years and 313 (37.2%) patients were males. MetS was detected in 662 (78.6%) patients. A progressive reduction in eGFR was observed as the number of individual MetS components increased (one: 98.2 ± 30.8; two: 92.9 ± 28.1; three: 84.0 ± 25.1; four: 83.8 ± 28.5, and five: 79.0 ± 23.0; P < 0.001). MetS increased the risk for low eGFR (<60 mL·min-1·1.73 (m²)-1) 2.82-fold (95%CI = 1.55-5.12, P < 0.001). Hypertension (OR = 2.2, 95%CI = 1.39-3.49, P = 0.001) and hypertriglyceridemia (OR = 1.62, 95%CI = 1.19-2.20, P = 0.002) were the individual components with the strongest associations with low eGFR. In conclusion, there is an association between MetS and the reduction of eGFR in patients with type 2 DM, with hypertension and hypertriglyceridemia being the most important contributors in this sample. Interventional studies should be conducted to determine if treatment of MetS can prevent renal failure in type 2 DM patients.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To explore whether an environment of weightlessness will cause damage to the reproductive system of animals, we used the tail-suspension model to simulate microgravity, and investigated the effect of microgravity on the tissue structure and function of the testis in sexually mature male rats. Forty-eight male Wistar rats weighing 200-250 g were randomly assigned to three groups (N = 16 each): control, tail traction, and tail suspension. After the rats were suspended for 7 or 14 days, morphological changes of testis were evaluated by histological and electron microscopic methods. The expression of HSP70, bax/bcl-2 and AR (androgen receptor) in testis was measured by immunohistochemistry. Obvious pathological lesions were present in the testis after the rats were suspended for 7 or 14 days. We detected overexpression of HSP70 and an increase of apoptotic cells, which may have contributed to the injury to the testis. The expression of AR, as an effector molecule in the testis, was significantly decreased in the suspended groups compared to control (P < 0.01). We also observed that, with a longer time of suspension, the aforementioned pathological damage became more serious and some pathological injury to the testis was irreversible. The results demonstrated that a short- or medium-term microgravity environment could lead to severe irreversible damage to the structure of rat testis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Thymosin alpha 1 (Tα1) has been shown to have beneficial effects on numerous immune system parameters, but little is known about the effects of Tα1 on patients with gastric carcinoma. The objective of this study was to determine the effect of Tα1 on subpopulations of Th1, Th2, Th17, and regulatory T cells (Tregs) in vitro, and to evaluate its efficacy as an immunoregulatory factor in patients with gastric carcinoma. We compared the effect of Tα1 on the frequency of CD4+ and CD8+ T cells, especially the CD4+CD25+Foxp3+ Tregs in peripheral blood mononuclear cells (PBMCs) from gastric carcinoma patients (N = 35) and healthy donors (N = 22). We also analyzed the changes in the proliferation of PBMCs in response to treatment with Tα1, and examined the production of Th1, Th2, and Th17 cytokines by PBMCs and tumor-infiltrating lymphocytes. The treatment of PBMCs from gastric cancer patients, with Tα1 (50 µg/mL) alone increased the percentage of CD4+CD25+Foxp3+ (suppressive antitumor-specific Tregs) from 1.68 ± 0.697 to 2.19 ± 0.795% (P < 0.05). Our results indicate that Tα1 increases the percentage of Tregs and IL-1β, TNF-α, and IL-6 in vitro.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The timing and mechanisms of protection by hyperbaric oxygenation (HBO) in hypoxic-ischemic brain damage (HIBD) have only been partially elucidated. We monitored the effect of HBO on the mitochondrial function of neuronal cells in the cerebral cortex of neonatal rats after HIBD. Neonatal Sprague-Dawley rats (total of 360 of both genders) were randomly divided into normal control, HIBD, and HIBD+HBO groups. The HBO treatment began immediately after hypoxia-ischemia (HI) and continued once a day for 7 consecutive days. Animals were euthanized 0, 2, 4, 6, and 12 h post-HI to monitor the changes in mitochondrial membrane potential (ΔΨm) occurring soon after a single dose of HBO treatment, as well as 2, 3, 4, 5, 6, and 7 days post-HI to study ΔΨm changes after a series of HBO treatments. Fluctuations in ΔΨm were observed in the ipsilateral cortex in both HIBD and HIBD+HBO groups. Within 2 to 12 h after HI insult, the ΔΨm of the HIBD and HIBD+HBO groups recovered to some extent. A secondary drop in ΔΨm was observed in both groups during the 1-4 days post-HI period, but was more severe in the HIBD+HBO group. There was a secondary recovery of ΔΨm observed in the HIBD+HBO group, but not in the HIBD group, during the 5-7 days period after HI insult. HBO therapy may not lead to improvement of neural cell mitochondrial function in the cerebral cortex in the early stage post-HI, but may improve it in the sub-acute stage post-HI.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Dulce de leche (DL), a dairy dessert highly appreciated in Brazil, is a concentrated product containing about 70% m/m of total solids. Thermophysical and rheological properties of two industrial Brazilian Dulce de leche formulations (classic Dulce de leche and Dulce de leche added with coconut flakes 1.5% m/m) were determined at temperatures comprised between 28.4 and 76.4 °C. In general, no significant differences (p < 0.05) were observed in the presence of coconut flakes in the two formulations. Heat capacity varied from 2633.2 to 3101.8 J/kg.°C; thermal conductivity from 0.383 to 0.452 W/m.°C; specific mass from 1350.7 to 1310.7 kg/m³; and, thermal diffusivity from (1.082 × 10-7 to 1.130 × 10-7) m²/s. The Bingham model was used to properly describe the non-Newtonian behavior of both formulations, with yielding stress values varying from 27.3 to 17.6 Pa and plastic viscosity from 19.9 to 5.9 Pa.s.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In Brazil, the largest producer of sugarcane in the world, the industrial process transforms this crop into ethanol and/or granulated sugar. Some cultivars exhibit enzymatic browning in the extracted sugarcane juice at levels harmful to the manufacturing process of white granulated sugar. The objective of this study was to assess the effect of sugarcane straw used as soil coverage, the use of different planting systems, and treatments with hydrogel polymer on enzymatic activity. The cultivar RB 86 7515 was sampled for 8 months; the first sample was obtained by cutting the upper portion of the stalk at the internode, which was taken to the laboratory for determination of the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The soil coverage with different forms of straw as well as the planting systems did not change the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The polyphenoloxidase (PPO) activity increased with the use of a polymer due to increased polyphenoloxidase (PPO) activity in the groove system. The enzymes studied showed changes in activity during the experimental period. The production of sugar at the end of the season (August to November) avoids the periods of highest enzymatic activity.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Jackfruit tree is one of the most significant trees in tropical home gardens and perhaps the most widespread and useful tree in the important genus Artocarpus. The fruit is susceptible to mechanical and biological damage in the mature state, and some people find the aroma of the fruit objectionable, particularly in confined spaces. The dehydration process could be an alternative for the exploitation of this product, and the relationship between moisture content and water activity provides useful information for its processing and storage. The aim of this study was to determine the thermodynamic properties of the water sorption of jackfruit (Artocarpus heterophyllus Lam.) as a function of moisture content. Desorption isotherms of the different parts of the jackfruit (pulp, peduncle, mesocarp, peel, and seed) were determined at four different temperatures (313.15, 323.15, 333.15, and 343.15 K) in a water activity range of 0.02-0.753 using the static gravimetric method. Theoretical and empirical models were used to model the desorption isotherms. An analytical solution of the Clausius-Clapeyron equation was proposed to calculate the isosteric heat of sorption, the differential entropy, and Gibbs' free energy using the Guggenhein-Anderson-de Boer and Oswin models considering the effect of temperature on the hygroscopic equilibrium.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Hot and dry weather conditions during soybean [Glycine max (L.) Merrill] seed maturation can cause forced maturation of the seed, resulting in the production of high levels of green seed, which may be detrimental to seed germination. These stressful conditions were imposed on soybean plants during seed maturation to investigate the production of green seeds and seed quality. Plants of the CD 206 cultivar were grown in a greenhouse until the R5.5 growing stage and then transferred to phytotrons at R6 and R7.2 for stress induction. Plants were subjected to two temperature regimes, high (28ºC to 36ºC) and normal (19ºC to 26ºC), and four soil water availability conditions, control (adequate water supply), 30% gravimetric moisture (GM), 20% GM and no water supply. Seed were harvested at R9. Green seed percentages and 100-seed weights from the lower, middle and upper thirds of each plant were determined. Seed quality was assessed by germination, tetrazolium (viability and vigor) and electrical conductivity tests. Occurrence of green seed varied from 9% to 86%, depending on the severity of the stresses imposed. High temperature, coupled with no water supply at R6, resulted in a pronounced occurrence of green seeds. There was no difference in the percentage of green seeds among the plant segments. Seed quality was negatively affected by the incidence of green seeds. A procedure for screening soybean genotypes in a phytotron for their tolerance and/or susceptibility to the production of green seeds was developed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The study centers on the power of Right-Wing Authoritarianism (RWA) and Social Dominance Orientation (SDO) as predictors of prejudice against stereotypical and nonstereotypical homosexuals under the threat of death and the threat of uncertainty. Right-wing authoritarianism (RWA) is an individual difference variable that measures the tendency for individuals to unquestionably follow those perceived to be authorities. Social Dominance Orientation (SDO) is an individual difference variable that measures the degree to which an individual prefers inequality among social groups. The RWA and SDO Scales are considered to be two of the strongest predictors of prejudice, such as prejudice against homosexuals. The study focuses on the unique predictive power of these two variables in predicting prejudice against homosexuals. The study also examines the role of situational threat in prejudice, specifically the threat of death (mortality salience) and the threat of uncertainty (uncertainty salience). Competing predictions from theories involving the threat of death (Terror Management Theory) and the threat of uncertainty (Uncertainty Management Theory) are also tested. The preference for expected information in the form of stereotypes concerning male homosexuals (that is, a stereotypical or non-stereotypical homosexual) were tested. The difference between the predictive power ofRWA and SDO was examined by measuring how these variables predict liking of a stereotypical or non-stereotypical homosexual under the threat of death, the threat of uncertainty, or a control condition. Along with completing a measure for RWA and a measure for SDO, participants were asked to think of their own death, of their being uncertain or about watching television then were asked to read about a week in the life of either a stereotypical or non-stereotypical male homosexual. Participants were then asked to evaluate the individual and his essay. Based on the participants' evaluations, results from 180 heterosexual university students show that RWA and SDO are strong predictors for disliking of a stereotypical homosexual under the threat of uncertainty and disliking of a non-stereotypical homosexual under the threat of death. Furthermore, however, results show that RWA is a particularly strong predictor of disliking of a stereotypical homosexual under the threat of uncertainty, whereas SDO is an exceptionally strong predictor of disliking of the non-stereotypical homosexual under the threat of death. This further adds to the notion that RWA and SDO are indeed unique predictors of prejudice. Implications are also explored, including the fact that the study simuhaneously examined the role of individual difference variables and situational threat variables, as well as exploratory analysis on Dominating Authoritarians.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objective: The adventitia has been recognized to play important roles in vascular oxidative stress, remodelling and contraction. We recently demonstrated that adventitial fibroblasts are able to express endothelin-1 (ET-1) in response to angiotensin II (ANG II). However, the mechanisms by which ANG II induces ET-1 expression are unknown. It is also unclear whether the ET-1 receptors are expressed in the adventitia. We therefore examined the role of oxidative stress in the regulation of ET-1. We also investigated the expression of both the ETA and ETB receptors and the roles of these two types of receptors in collagen synthesis and ET-1 clearance in adventitial fibroblasts. Methods and Results: Adventitial fibroblasts were isolated and cultured from the thoracic mouse aorta. Cells were treated with ANG II (lOOnM), ET-1 (lOpM), NADPH oxidase inhibitor apocynin (lOOfiM), the superoxide anion scavenger tempol (lOOfiM), the ANG II receptor antagonists (100[aM), losartan (AT| receptor) and PD 1233 19 (AT2 receptor), the ET-1 receptor antagonists (lOOuM), BQ123 (ETA receptor) and BQ788 (ETB receptor), and the ETB receptor agonist (lOOnM) Sarafotoxin 6C. ET-1 peptide levels were determined by ELISA, while ETA ,ETB and collagen levels were determined by Western blot. ANG II increased ET-1 peptide levels in a time-dependent manner reaching significance when incubated for 24 hours. NAD(P)H oxidase inhibitor, apocynin, as well as the superoxide scanverger, tempol, significantly reduced ANG Il-induced ET-1 peptide levels while over-expression of SOD1 (endogenous antioxidant enzyme) significantly decreased ANG Il-induced collagen I expression, therefore implicating reactive oxygen species in the mediation of ET-1. ANG II increased ETA receptor protein as well as collagen in a similar fashion, reaching significance after 4, 6, and 24 hours treatment. ANG II induced collagen was reduced while in the presence of the ETA receptor antagonist suggesting the role of the ETa receptor in the regulation of the extracellular matrix. ANG II treatment also increased ETB receptor protein levels in a time-dependent manner. ANG II treatment in the presence of the ETB receptor antagonist significantly increased ET-1 peptide levels. On another hand, the ETB receptor agonist, Sarafotoxin 6C, significantly decreased ET-1 peptide levels. These data implicate the role of the ETb receptor in the clearance of the ET-1 peptide. Conclusion: ANG II-induced increases of ET-1 peptide appears to be mediated by reactive oxygen species derived from NAD(P)H oxidase. Both the ETA and ETB receptors are expressed in adventitial fibroblasts. The ETA receptor subtype mediates collagen I expression, while the ETB receptor may play a protective role through increasing the clearance of the ET- 1 peptide.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Order parameter profiles extracted from the NMR spectra of model membranes are a valuable source of information about their structure and molecular motions. To al1alyze powder spectra the de-Pake-ing (numerical deconvolution) ~echnique can be used, but it assumes a random (spherical) dist.ribution of orientations in the sample. Multilamellar vesicles are known to deform and orient in the strong magnetic fields of NMR magnets, producing non-spherical orientation distributions. A recently developed technique for simultaneously extracting the anisotropies of the system as well as the orientation distributions is applied to the analysis of partially magnetically oriented 31p NMR spectra of phospholipids. A mixture of synthetic lipids, POPE and POPG, is analyzed to measure distortion of multilamellar vesicles in a magnetic field. In the analysis three models describing the shape of the distorted vesicles are examined. Ellipsoids of rotation with a semiaxis ratio of about 1.14 are found to provide a good approximation of the shape of the distorted vesicles. This is in reasonable agreement with published experimental work. All three models yield clearly non-spherical orientational distributions, as well as a precise measure of the anisotropy of the chemical shift. Noise in the experimental data prevented the analysis from concluding which of the three models is the best approximation. A discretization scheme for finding stability in the algorithm is outlined