920 resultados para MITOCHONDRIAL-DNA SEQUENCES


Relevância:

90.00% 90.00%

Publicador:

Resumo:

Avian malaria studies have taken a prominent place in different aspects of evolutionary ecology. Despite a recent interest in the role of vectors within the complex interaction system of the malaria parasite, they have largely been ignored in most epidemiological studies. Epidemiology of the disease is however strongly related to the vector's ecology and behaviour, and there is a need for basic investigations to obtain a better picture of the natural associations between Plasmodium lineages, vector species and bird hosts. The aim of the present study was to identify the mosquito species involved in the transmission of the haemosporidian parasites Plasmodium spp. in two wild populations of breeding great tits (Parus major) in western Switzerland. Additionally, we compared Plasmodium lineages, based on mitochondrial DNA cytochrome b sequences, between the vertebrate and dipteran hosts, and evaluated the prevalence of the parasite in the mosquito populations. Plasmodium spp. were detected in Culex pipiens only, with an overall 6.6% prevalence. Among the six cytochrome b lineages of Plasmodium identified in the mosquitoes, three were also present in great tits. The results provide evidence for the first time that C. pipiens can act as a natural vector of avian malaria in Europe and yield baseline data for future research on the epidemiology of avian malaria in European countries.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Accurate prediction of transcription factor binding sites is needed to unravel the function and regulation of genes discovered in genome sequencing projects. To evaluate current computer prediction tools, we have begun a systematic study of the sequence-specific DNA-binding of a transcription factor belonging to the CTF/NFI family. Using a systematic collection of rationally designed oligonucleotides combined with an in vitro DNA binding assay, we found that the sequence specificity of this protein cannot be represented by a simple consensus sequence or weight matrix. For instance, CTF/NFI uses a flexible DNA binding mode that allows for variations of the binding site length. From the experimental data, we derived a novel prediction method using a generalised profile as a binding site predictor. Experimental evaluation of the generalised profile indicated that it accurately predicts the binding affinity of the transcription factor to natural or synthetic DNA sequences. Furthermore, the in vitro measured binding affinities of a subset of oligonucleotides were found to correlate with their transcriptional activities in transfected cells. The combined computational-experimental approach exemplified in this work thus resulted in an accurate prediction method for CTF/NFI binding sites potentially functioning as regulatory regions in vivo.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

DNA methylation regulates many processes, including gene expression, by superimposing secondary information on DNA sequences. The conserved CcrM enzyme, which methylates adenines in GANTC sequences, is essential to the viability of several Alphaproteobacteria. In this study, we find that Caulobacter crescentus cells lacking the CcrM enzyme accumulate low levels of the two conserved FtsZ and MipZ proteins, leading to a severe defect in cell division. This defect can be compensated by the expression of the ftsZ gene from an inducible promoter or by spontaneous suppressor mutations that promote FtsZ accumulation. We show that CcrM promotes the transcription of the ftsZ and mipZ genes and that the ftsZ and mipZ promoter regions contain a conserved CGACTC motif that is critical to their activities and to their regulation by CcrM. In addition, our results suggest that the ftsZ promoter has the lowest activity when the CGACTC motif is non-methylated, an intermediate activity when it is hemi-methylated and the highest activity when it is fully methylated. The regulation of ftsZ expression by DNA methylation may explain why CcrM is essential in a subset of Alphaproteobacteria.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Colour pattern diversity can be due to random processes or to natural or sexual selection. Consequently, similarities in colour patterns are not always correlated with common ancestry, but may result from convergent evolution under shared selection pressures or drift. Neolamprologus brichardi and Neolamprologus pulcher have been described as two distinct species based on differences in the arrangement of two dark bars on the operculum. Our study uses DNA sequences of the mitochondrial control region to show that relatedness of haplotypes disagrees with species assignment based on head colour pattern. This suggests repeated parallel evolution of particular stripe patterns. The complete lack of shared haplotypes between populations of the same or different phenotypes reflects strong philopatric behaviour, possibly induced by the cooperative breeding mode in which offspring remain in their natal territory and serve as helpers until they disperse to nearby territories or take over a breeding position. Concordant phylogeographic patterns between N. brichardi/N. pulcher populations and other rock-dwelling cichlids suggest that the same colonization routes have been taken by sympatric species and that these routes were affected by lake level fluctuations in the past.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The common shrew Sorex araneus Linnaeus, 1758 is subject to intense chromosomal polymorphism. About 65 chromosome races are presently known. One of these chromosome races (the Valais race) is karyologically, morphologically, biochemically, and genetically clearly distinct from all other chromosome races of the species. Recent studies of hybrid zones between the Valais race and other chromosome races in the Swiss and French Alps add further strong evidence for the specific taxonomic status of the Valais race. Chromosomes and diagnostic protein markers reveal sharp frequency clines and strong heterozygote deficits. In one hybrid zone, the maintenance of the strong genetic differentiation of the hybridizing taxa was confirmed by a study with autosomal microsatellites indicating minimal gene flow. A microsatellite marker on the Y-chromosome showed complete absence of male mediated gene flow suggesting hybrid male sterility. To clarify the taxonomic status of this taxon, additional analyses were conducted. A morphometric analysis of the mandible indicated the Valais race is morphologically as distinct from neighbouring chromosome races of S. araneus as from other related Sorex species. In a phylogeny based on complete mitochondrial DNA cytochrome b gene sequences, the Valais race clearly appears as the sister taxon to all other races of S. araneus. Therefore, the chromosome race Valais of S. araneus herein is elevated to specific status and the name Sorex antinorii Bonaparte, 1840 is applied.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Background: Oxidative stress is a probable cause of aging and associated diseases. Reactive oxygen species (ROS) originate mainly from endogenous sources, namely the mitochondria. Methodology/Principal Findings: We analyzed the effect of aerobic metabolism on oxidative damage in Schizosaccharomyces pombe by global mapping of those genes that are required for growth on both respiratory-proficient media and hydrogen-peroxide-containing fermentable media. Out of a collection of approximately 2700 haploid yeast deletion mutants, 51 were sensitive to both conditions and 19 of these were related to mitochondrial function. Twelve deletion mutants lacked components of the electron transport chain. The growth defects of these mutants can be alleviated by the addition of antioxidants, which points to intrinsic oxidative stress as the origin of the phenotypes observed. These respiration-deficient mutants display elevated steady-state levels of ROS, probably due to enhanced electron leakage from their defective transport chains, which compromises the viability of chronologically-aged cells. Conclusion/Significance: Individual mitochondrial dysfunctions have often been described as the cause of diseases or aging, and our global characterization emphasizes the primacy of oxidative stress in the etiology of such processes.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Direct evidence confirming the hypothesis that a dysfunction of the mitochondrial respiratory chain (MRC) underlies the pathogenesis of hyperlactatemia associated with highly active antiretroviral therapy (HAART) is scarce. We studied mitochondrial DNA (mtDNA) content and MRC function in the skeletal muscle of an HIV-infected patient during an episode of symptomatic hyperlactatemia. Skeletal muscle biopsy was performed during the episode when the patient was symptomatic and 3 months later when the patient was clinically recovered. Assessment of mitochondria was performed using histological, polarographic, spectrophotometrical, and Southern blot and real time PCR DNA quantification methods. The histological study disclosed extensive mitochondrial impairment in the form of ragged-red fibers or equivalents on oxidative reactions. These findings were associated with an increase in mitochondrial content and a decrease in both mitochondrial respiratory capacity and MRC enzyme activities. Mitochondrial DNA content declined to 53% of control values. Mitochondrial abnormalities had almost disappeared later when the patient became asymptomatic. Our findings support the hypothesis that MRC dysfunction stands at the basis of HAART-related hyperlactatemia.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Direct evidence confirming the hypothesis that a dysfunction of the mitochondrial respiratory chain (MRC) underlies the pathogenesis of hyperlactatemia associated with highly active antiretroviral therapy (HAART) is scarce. We studied mitochondrial DNA (mtDNA) content and MRC function in the skeletal muscle of an HIV-infected patient during an episode of symptomatic hyperlactatemia. Skeletal muscle biopsy was performed during the episode when the patient was symptomatic and 3 months later when the patient was clinically recovered. Assessment of mitochondria was performed using histological, polarographic, spectrophotometrical, and Southern blot and real time PCR DNA quantification methods. The histological study disclosed extensive mitochondrial impairment in the form of ragged-red fibers or equivalents on oxidative reactions. These findings were associated with an increase in mitochondrial content and a decrease in both mitochondrial respiratory capacity and MRC enzyme activities. Mitochondrial DNA content declined to 53% of control values. Mitochondrial abnormalities had almost disappeared later when the patient became asymptomatic. Our findings support the hypothesis that MRC dysfunction stands at the basis of HAART-related hyperlactatemia.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

A photoactivated ruthenium(II) arene complex has been conjugated to two receptor-binding peptides, a dicarba analogue of octreotide and the Arg-Gly-Asp (RGD) tripeptide. These peptides can act as"tumor-targeting devices" since their receptors are overexpressed on the membranes of tumor cells. Both ruthenium-peptide conjugates are stable in aqueous solution in the dark, but upon irradiation with visible light, the pyridyl-derivatized peptides were selectively photodissociated from the ruthenium complex, as inferred by UV-vis and NMR spectroscopy. Importantly, the reactive aqua species generated from the conjugates, [(η6-p-cym)Ru(bpm)(H2O)]2+, reacted with the model DNA nucleobase 9-ethylguanine as well as with guanines of two DNA sequences, 5′dCATGGCT and 5′dAGCCATG. Interestingly, when irradiation was performed in the presence of the oligonucleotides, a new ruthenium adduct involving both guanines was formed as a consequence of the photodriven loss of p-cymene from the two monofunctional adducts. The release of the arene ligand and the formation of a ruthenated product with a multidentate binding mode might have important implications for the biological activity of such photoactivated ruthenium(II) arene complexes. Finally, photoreactions with the peptide-oligonucleotide hybrid, Phac-His-Gly-Met-linker-p5′dCATGGCT, also led to arene release and to guanine adducts, including a GG chelate. The lack of interaction with the peptide fragment confirms the preference of such organometallic ruthenium(II) complexes for guanine over other potential biological ligands, such as histidine or methionine amino acids.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The untargeted integration of foreign DNA into the mammalian cell genome, extensively used in gene therapy and biotechnology, remains an incompletely understood process. It is believed to be based on cellular DNA double strand break (DSB) repair machinery and to involve two major steps: i) the formation of long gene arrays (concatemers), and ii) recombination of the resulting concatemer with the genome. The main DSB repair pathways in eukaryotes include non-homologous end-joining (NHEJ), homologous recombination (HR), and microhomology-mediated end-joining (MMEJ). However, it is still not clear, which of these pathways are responsible for transgene integration. Here, we show that NHEJ is not the primary pathway used by mammalian cells in the transgene integration process, while the components of the HR pathway seem to be important for genomic integration but not concatemerization. Instead, concatemer formation appears to be mediated by a subset of the MMEJ pathway, termed synthesis-dependent MMEJ (SD-MMEJ). This mechanism also seems to be preferentially used for plasmid integration into the genome, as confirmed by the analysis of plasmid-to-genome junction sequences, which were found to display an SD-MMEJ pattern. Therefore, we propose the existence of two distinct SD-MMEJ subpathways, relying on different subsets of enzymes. One of these mechanisms appears to be responsible for concatemerization, while the other mechanism, partially dependent in HR enzymes, seems to mediate recombination with the genome. Previous studies performed by our group suggested that matrix attachment regions (MARs), which are epigenetic regulatory DNA elements that participate in the formation of chromatin boundaries and augment transcription, may mediate increased plasmid integration into the genome of CHO cells by stimulating DNA recombination. In the present work, we demonstrate that MAR-mediated plasmid integration results from the enhanced SD-MMEJ pathway. Analysis of transgene integration loci and junction DNA sequences validated the prevalent use of this pathway by the MAR elements to target plasmid DNA into gene-rich areas of the CHO genome. We propose that this finding should in the future help to engineer cells for improved recombinant protein production. In addition to investigating the process of transgene integration, we designed recombination assays to better characterize the components of the MMEJ and SD-MMEJ pathways. We also used CHO cells expressing cycle-sensitive reporter genes to demonstrate a potential role of HR proteins in the cell cycle regulation.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Direct evidence confirming the hypothesis that a dysfunction of the mitochondrial respiratory chain (MRC) underlies the pathogenesis of hyperlactatemia associated with highly active antiretroviral therapy (HAART) is scarce. We studied mitochondrial DNA (mtDNA) content and MRC function in the skeletal muscle of an HIV-infected patient during an episode of symptomatic hyperlactatemia. Skeletal muscle biopsy was performed during the episode when the patient was symptomatic and 3 months later when the patient was clinically recovered. Assessment of mitochondria was performed using histological, polarographic, spectrophotometrical, and Southern blot and real time PCR DNA quantification methods. The histological study disclosed extensive mitochondrial impairment in the form of ragged-red fibers or equivalents on oxidative reactions. These findings were associated with an increase in mitochondrial content and a decrease in both mitochondrial respiratory capacity and MRC enzyme activities. Mitochondrial DNA content declined to 53% of control values. Mitochondrial abnormalities had almost disappeared later when the patient became asymptomatic. Our findings support the hypothesis that MRC dysfunction stands at the basis of HAART-related hyperlactatemia.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Direct evidence confirming the hypothesis that a dysfunction of the mitochondrial respiratory chain (MRC) underlies the pathogenesis of hyperlactatemia associated with highly active antiretroviral therapy (HAART) is scarce. We studied mitochondrial DNA (mtDNA) content and MRC function in the skeletal muscle of an HIV-infected patient during an episode of symptomatic hyperlactatemia. Skeletal muscle biopsy was performed during the episode when the patient was symptomatic and 3 months later when the patient was clinically recovered. Assessment of mitochondria was performed using histological, polarographic, spectrophotometrical, and Southern blot and real time PCR DNA quantification methods. The histological study disclosed extensive mitochondrial impairment in the form of ragged-red fibers or equivalents on oxidative reactions. These findings were associated with an increase in mitochondrial content and a decrease in both mitochondrial respiratory capacity and MRC enzyme activities. Mitochondrial DNA content declined to 53% of control values. Mitochondrial abnormalities had almost disappeared later when the patient became asymptomatic. Our findings support the hypothesis that MRC dysfunction stands at the basis of HAART-related hyperlactatemia.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Mitochondria has an essential role in myocardial tissue homeostasis; thus deterioration in mitochondrial function eventually leads to cardiomyocyte and endothelial cell death and consequent cardiovascular dysfunction. Several chemical compounds and drugs have been known to directly or indirectly modulate cardiac mitochondrial function, which can account both for the toxicological and pharmacological properties of these substances. In many cases, toxicity problems appear only in the presence of additional cardiovascular disease conditions or develop months/years following the exposure, making the diagnosis difficult. Cardiotoxic agents affecting mitochondria include several widely used anticancer drugs [anthracyclines (Doxorubicin/Adriamycin), cisplatin, trastuzumab (Herceptin), arsenic trioxide (Trisenox), mitoxantrone (Novantrone), imatinib (Gleevec), bevacizumab (Avastin), sunitinib (Sutent), and sorafenib (Nevaxar)], antiviral compound azidothymidine (AZT, Zidovudine) and several oral antidiabetics [e.g., rosiglitazone (Avandia)]. Illicit drugs such as alcohol, cocaine, methamphetamine, ecstasy, and synthetic cannabinoids (spice, K2) may also induce mitochondria-related cardiotoxicity. Mitochondrial toxicity develops due to various mechanisms involving interference with the mitochondrial respiratory chain (e.g., uncoupling) or inhibition of the important mitochondrial enzymes (oxidative phosphorylation, Szent-Györgyi-Krebs cycle, mitochondrial DNA replication, ADP/ATP translocator). The final phase of mitochondrial dysfunction induces loss of mitochondrial membrane potential and an increase in mitochondrial oxidative/nitrative stress, eventually culminating into cell death. This review aims to discuss the mechanisms of mitochondrion-mediated cardiotoxicity of commonly used drugs and some potential cardioprotective strategies to prevent these toxicities.