957 resultados para Directly modulated semiconductor lasers
Resumo:
We measured human contrast sensitivity to radial frequencies modulated by cylindrical (Jo) and spherical (j o) Bessel profiles. We also measured responses to profiles of j o, j1, j2, j4, j8, and j16. Functions were measured three times by at least three of eight observers using a forced-choice method. The results conform to our expectations that sensitivity would be higher for cylindrical profiles. We also observed that contrast sensitivity is increased with the j n order for n greater than zero, having distinct orderly effects at the low and high frequency ends. For n = 0, 1, 2, and 4 sensitivity tended to occur around 0.8-1.0 cpd while for n = 8 and 16 it seemed to shift gradually to 0.8-3.0 cpd. We interpret these results as being consistent with the possibility that spatial frequency processing by the human visual system can be defined a priori in terms of polar coordinates and discuss its application to study face perception.
Resumo:
Defects in semiconductor crystals and at their interfaces usually impair the properties and the performance of devices. These defects include, for example, vacancies (i.e., missing crystal atoms), interstitials (i.e., extra atoms between the host crystal sites), and impurities such as oxygen atoms. The defects can decrease (i) the rate of the radiative electron transition from the conduction band to the valence band, (ii) the amount of charge carriers, and (iii) the mobility of the electrons in the conduction band. It is a common situation that the presence of crystal defects can be readily concluded as a decrease in the luminescence intensity or in the current flow for example. However, the identification of the harmful defects is not straightforward at all because it is challenging to characterize local defects with atomic resolution and identification. Such atomic-scale knowledge is however essential to find methods for reducing the amount of defects in energy-efficient semiconductor devices. The defects formed in thin interface layers of semiconductors are particularly difficult to characterize due to their buried and amorphous structures. Characterization methods which are sensitive to defects often require well-defined samples with long range order. Photoelectron spectroscopy (PES) combined with photoluminescence (PL) or electrical measurements is a potential approach to elucidate the structure and defects of the interface. It is essential to combine the PES with complementary measurements of similar samples to relate the PES changes to changes in the interface defect density. Understanding of the nature of defects related to III-V materials is relevant to developing for example field-effect transistors which include a III-V channel, but research is still far from complete. In this thesis, PES measurements are utilized in studies of various III-V compound semiconductor materials. PES is combined with photoluminescence measurements to study the SiO2/GaAs, SiNx/GaAs and BaO/GaAs interfaces. Also the formation of novel materials InN and photoluminescent GaAs nanoparticles are studied. Finally, the formation of Ga interstitial defects in GaAsN is elucidated by combining calculational results with PES measurements.
Resumo:
We determined the influence of fasting (FAST) and feeding (FED) on cholesteryl ester (CE) flow between high-density lipoproteins (HDL) and plasma apoB-lipoprotein and triacylglycerol (TG)-rich emulsions (EM) prepared with TG-fatty acids (FAs). TG-FAs of varying chain lengths and degrees of unsaturation were tested in the presence of a plasma fraction at d > 1.21 g/mL as the source of CE transfer protein. The transfer of CE from HDL to FED was greater than to FAST TG-rich acceptor lipoproteins, 18% and 14%, respectively. However, percent CE transfer from HDL to apoB-containing lipoproteins was similar for FED and FAST HDL. The CE transfer from HDL to EM depended on the EM TG-FA chain length. Furthermore, the chain length of the monounsaturated TG-containing EM showed a significant positive correlation of the CE transfer from HDL to EM (r = 0.81, P < 0.0001) and a negative correlation from EM to HDL (r = -041, P = 0.0088). Regarding the degree of EM TG-FAs unsaturation, among EMs containing C18, the CE transfer was lower from HDL to C18:2 compared to C18:1 and C18:3, 17.7%, 20.7%, and 20%, respectively. However, the CE transfer from EMs to HDL was higher to C18:2 than to C18:1 and C18:3, 83.7%, 51.2%, and 46.3%, respectively. Thus, the EM FA composition was found to be the rate-limiting factor regulating the transfer of CE from HDL. Consequently, the net transfer of CE between HDL and TG-rich particles depends on the specific arrangement of the TG acyl chains in the lipoprotein particle core.
Resumo:
The phosphorylation of cardiac troponin I (cTnI) plays an important role in the contractile dysfunction associated with heart failure. Human cardiac troponin I-interacting kinase (TNNI3K) is a novel cardiac-specific functional kinase that can bind to cTnI in a yeast two-hybrid screen. The purpose of this study was to investigate whether TNNI3K can phosphorylate cTnI at specific sites and to examine whether the phosphorylation of cTnI caused by TNNI3K can regulate cardiac myofilament contractile function. Co-immunoprecipitation was performed to confirm that TNNI3K could interact with cTnI. Kinase assays further indicated that TNNI3K did not phosphorylate cTnI at Ser23/24 and Ser44, but directly phosphorylated Ser43 and Thr143 in vitro. The results obtained for adult rat cardiomyocytes also indicated that enhanced phosphorylation of cTnI at Ser43 and Thr143 correlated with rTNNI3K (rat TNNI3K) overexpression, and phosphorylation was reduced when rTNNI3K was knocked down. To determine the contractile function modulated by TNNI3K-mediated phosphorylation of cTnI, cardiomyocyte contraction was studied in adult rat ventricular myocytes. The contraction of cardiomyocytes increased with rTNNI3K overexpression and decreased with rTNNI3K knockdown. We conclude that TNNI3K may be a novel mediator of cTnI phosphorylation and contribute to the regulation of cardiac myofilament contraction function.
Resumo:
Ca2+ pumps are important players in smooth muscle contraction. Nevertheless, little information is available about these pumps in the vas deferens. We have determined which subtype of sarco(endo)plasmic reticulum Ca2+-ATPase isoform (SERCA) is expressed in rat vas deferens (RVD) and its modulation by calmodulin (CaM)-dependent mechanisms. The thapsigargin-sensitive Ca2+-ATPase from a membrane fraction containing the highest SERCA levels in the RVD homogenate has the same molecular mass (∼115 kDa) as that of SERCA2 from the rat cerebellum. It has a very high affinity for Ca2+ (Ca0.5 = 780 nM) and a low sensitivity to vanadate (IC50 = 41 µM). These facts indicate that SERCA2 is present in the RVD. Immunoblotting for CaM and Ca2+/calmodulin-dependent protein kinase II (CaMKII) showed the expression of these two regulatory proteins. Ca2+ and CaM increased serine-phosphorylated residues of the 115-kDa protein, indicating the involvement of CaMKII in the regulatory phosphorylation of SERCA2. Phosphorylation is accompanied by an 8-fold increase of thapsigargin-sensitive Ca2+ accumulation in the lumen of vesicles derived from these membranes. These data establish that SERCA2 in the RVD is modulated by Ca2+ and CaM, possibly via CaMKII, in a process that results in stimulation of Ca2+ pumping activity.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T4endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T4endonuclease V. Low-intensity lasers:i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells,ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, andiv) did not alter the electrophoretic profile of plasmids incubated with T4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers.
Resumo:
Semiconductor laser devices are readily available and practical radiation sources providing wavelength tenability and high monochromaticity. Low-intensity red and near-infrared lasers are considered safe for use in clinical applications. However, adverse effects can occur via free radical generation, and the biological effects of these lasers from unusually high fluences or high doses have not yet been evaluated. Here, we evaluated the survival, filamentation induction and morphology of Escherichia coli cells deficient in repair of oxidative DNA lesions when exposed to low-intensity red and infrared lasers at unusually high fluences. Cultures of wild-type (AB1157), endonuclease III-deficient (JW1625-1), and endonuclease IV-deficient (JW2146-1) E. coli, in exponential and stationary growth phases, were exposed to red and infrared lasers (0, 250, 500, and 1000 J/cm2) to evaluate their survival rates, filamentation phenotype induction and cell morphologies. The results showed that low-intensity red and infrared lasers at high fluences are lethal, induce a filamentation phenotype, and alter the morphology of the E. coli cells. Low-intensity red and infrared lasers have potential to induce adverse effects on cells, whether used at unusually high fluences, or at high doses. Hence, there is a need to reinforce the importance of accurate dosimetry in therapeutic protocols.
Resumo:
Avhandlingen handlar om pappers- och membranbaserad jonmodulerad elektronik. Målet med forskningen har varit att utveckla billig, miljövänlig och brännbar elektronik, som kan användas i vardagliga engångsprodukter. Baskomponenterna som utvecklas och presenteras i avhandlingen är transistorer och kondensatorer. Mer komplicerad logisk kretselektronik demonstreras också med hjälp av dessa komponenter. Substraten som utnyttjas vid framställningen av dessa elektroniska komponenter är papper och membran. Dessa substrat är flexibla, hållbara, billiga, miljövänliga, etc. och därför väl anpassade för befintliga tryckteknologier. Själva baskomponenterna framställs sedan på dessa substrat genom att trycka flera skikt på varandra, där varje enskilt skikt är ett individuellt material. Detta är möjligt eftersom de organiska materialen som används i dessa komponenter är upplösta i ett lösningsmedel och kan därmed tryckas på samma sätt som ett vanligt bläck. Ett tredimensionellt objekt kan på detta sätt framställas. I avhandlingen presenteras flera olika typer av transistorer, men den gemensamma nämnaren bland dessa är att isolatorn är en jonledare. Denna, ganska ovanliga, transistormodellen har den stora fördelen att lågspänningskomponenter kan relativt enkelt framställas. Det som är speciellt med våra transistorer är att vi har använt miljövänliga jonledare. Detta, bl.a., leder till att våra komponenter visar både god prestanda, tillika som de är miljövänliga. I avhandlingen demonstrerar vi även tryckta superkondensatorer, en motsvarighet till laddningsbara batterier, konstruerade på papper med aktiverat kol och miljövänliga jonledare. De mest komplicerade logiska kretsar som demonstreras i denna avhandling är ring-oscillatorer och 1-bits-minnen konstruerade på papper. --------------------------------------------- Väitöskirja käsittelee paperille ja polymeerikalvolle tulostettua ionimoduloitua elektroniikkaa. Tutkimuksen tavoitteena oli kehittää edullista, ympäristöystävällistä ja polttokelpoista elektroniikkaa, jota voidaan käyttää esim. tavanomaisissa kertakäyttötuotteissa. Väitöskirjassa esitellään erilaisia transistoreita ja kondensaattoreita. Näitä elektronisia peruskomponentteja käyttäen demonstroidaan myös monimutkaisempia loogisia piirejä. Komponenttien valmistuksessa alustana käytettiin paperia ja polymeerikalvoa. Valitut alustat ovat joustavia ja kestäviä, ja ovat siksi hyvin yhteensopivia olemassa olevien tulostusmenetelmien kanssa. Peruskomponentit valmistettiin tulostamalla eri materiaaleja päällekkäin. Komponenteissa käytettävät orgaaniset aineet ovat liuenneessa muodossa musteessa, joka voidaan tulostaa samalla periaatteella kuin mikä tahansa normaali muste. Tällä menetelmällä voidaan valmistaa myös kolmiulotteisia tuotteita. Väitöskirjassa esitellään useita erityyppisiä transistoreita, joissa yhdistävänä tekijänä on ionisesti johtava eriste. Tällaista suhteellisen harvinaista transistorityyppiä käyttämällä voidaan mahdollistaa matala-jännitteisten komponenttien yksinkertainen valmistus. Valmistettujen transistoreiden etu on ionisten nesteiden ympäristöystävällisyys. Elektroniset komponentit ovat täten hyviä suorituskyvyltään, mutteivät haitallisia ympäristölle. Väitöskirjassa demonstroidaan myös tulostettujen superkondensaattoreiden, eli ladattavien paristojen vastineiden, valmistus paperille aktiivihiiltä ja ionisia nesteitä käyttäen. Kaikkein monimutkaisimmat loogiset piirit, jotka tässä väitöskirjassa esitellään, ovat rengasoskillaattorit sekä 1-bittinen paperille valmistettu muisti.
Resumo:
Rice flour was processed by extrusion cooking in the presence of variable contents of water and sucrose. The process was carried out in a twin-screw extruder under the conditions given by a centre rotational experimental design of second order. The effects of the independent variables, water content (27.9 to 42.1%), and sucrose content (0.1 to 19.9%) on the physicochemical properties of the extrudates were investigated. The water absorption index (WAI), water solubility index (WSI), volumetric expansion index (VEI), and bulk density (BD) were determined as dependent variables. BD was determined for samples before and after frying. An increase in water contents resulted in higher WAI and VEI, and lower WSI and BD for extrudates before and after frying. Higher sucrose levels led to increased values of WAI and VEI and to reduced values of WSI and BD. Both independent variables had significant influence on the physicochemical properties of rice flour extrudates. However, the sucrose content was the most significant. The interaction between these two independent variables and their quadratic effect were also important for the responses studied.
Resumo:
This lexical decision study with eye tracking of Japanese two-kanji-character words investigated the order in which a whole two-character word and its morphographic constituents are activated in the course of lexical access, the relative contributions of the left and the right characters in lexical decision, the depth to which semantic radicals are processed, and how nonlinguistic factors affect lexical processes. Mixed-effects regression analyses of response times and subgaze durations (i.e., first-pass fixation time spent on each of the two characters) revealed joint contributions of morphographic units at all levels of the linguistic structure with the magnitude and the direction of the lexical effects modulated by readers’ locus of attention in a left-to-right preferred processing path. During the early time frame, character effects were larger in magnitude and more robust than radical and whole-word effects, regardless of the font size and the type of nonwords. Extending previous radical-based and character-based models, we propose a task/decision-sensitive character-driven processing model with a level-skipping assumption: Connections from the feature level bypass the lower radical level and link up directly to the higher character level.
Resumo:
Tesis (Maestría en Ciencias de la Ingeniería Mecánica con Especialidad en Materiales) UANL, 2010.
Resumo:
Nous investiguons dans ce travail la dynamique des excitons dans une couche mince d’agrégats H autoassemblés hélicoïdaux de molécules de sexithiophène. Le couplage intermoléculaire (J=100 meV) place ce matériau dans la catégorie des semi-conducteurs à couplage de type intermédiaire. Le désordre énergétique et la forte interaction électronsphonons causent une forte localisation des excitons. Les espèces initiales se ramifient en deux états distincts : un état d’excitons autopiégés (rendement de 95 %) et un état à transfert de charge (rendement de 5%). À température de la pièce (293K), les processus de sauts intermoléculaires sont activés et l’anisotropie de la fluorescence décroît rapidement à zéro en 5 ns. À basse température (14K), les processus de sauts sont gelés. Pour caractériser la dynamique de diffusion des espèces, une expérience d’anisotropie de fluorescence a été effectuée. Celle-ci consiste à mesurer la différence entre la photoluminescence polarisée parallèlement au laser excitateur et celle polarisée perpendiculairement, en fonction du temps. Cette mesure nous donne de l’information sur la dépolarisation des excitons, qui est directement reliée à leur diffusion dans la structure supramoléculaire. On mesure une anisotropie de 0,1 après 20 ns qui perdure jusqu’à 50ns. Les états à transfert de charge causent une remontée de l’anisotropie vers une valeur de 0,15 sur une plage temporelle allant de 50 ns jusqu’à 210 ns (période entre les impulsions laser). Ces résultats démontrent que la localisation des porteurs est très grande à 14K, et qu’elle est supérieure pour les espèces à transfert de charge. Un modèle numérique simple d’équations différentielles à temps de vie radiatif et de dépolarisation constants permet de reproduire les données expérimentales. Ce modèle a toutefois ses limitations, notamment en ce qui a trait aux mécanismes de dépolarisation des excitons.
Resumo:
Tesis (Doctor en Ingeniería de Materiales) UANL, 2013.
Resumo:
La douleur est une expérience perceptive comportant de nombreuses dimensions. Ces dimensions de douleur sont inter-reliées et recrutent des réseaux neuronaux qui traitent les informations correspondantes. L’élucidation de l'architecture fonctionnelle qui supporte les différents aspects perceptifs de l'expérience est donc une étape fondamentale pour notre compréhension du rôle fonctionnel des différentes régions de la matrice cérébrale de la douleur dans les circuits corticaux qui sous tendent l'expérience subjective de la douleur. Parmi les diverses régions du cerveau impliquées dans le traitement de l'information nociceptive, le cortex somatosensoriel primaire et secondaire (S1 et S2) sont les principales régions généralement associées au traitement de l'aspect sensori-discriminatif de la douleur. Toutefois, l'organisation fonctionnelle dans ces régions somato-sensorielles n’est pas complètement claire et relativement peu d'études ont examiné directement l'intégration de l'information entre les régions somatiques sensorielles. Ainsi, plusieurs questions demeurent concernant la relation hiérarchique entre S1 et S2, ainsi que le rôle fonctionnel des connexions inter-hémisphériques des régions somatiques sensorielles homologues. De même, le traitement en série ou en parallèle au sein du système somatosensoriel constitue un autre élément de questionnement qui nécessite un examen plus approfondi. Le but de la présente étude était de tester un certain nombre d'hypothèses sur la causalité dans les interactions fonctionnelle entre S1 et S2, alors que les sujets recevaient des chocs électriques douloureux. Nous avons mis en place une méthode de modélisation de la connectivité, qui utilise une description de causalité de la dynamique du système, afin d'étudier les interactions entre les sites d'activation définie par un ensemble de données provenant d'une étude d'imagerie fonctionnelle. Notre paradigme est constitué de 3 session expérimentales en utilisant des chocs électriques à trois différents niveaux d’intensité, soit modérément douloureux (niveau 3), soit légèrement douloureux (niveau 2), soit complètement non douloureux (niveau 1). Par conséquent, notre paradigme nous a permis d'étudier comment l'intensité du stimulus est codé dans notre réseau d'intérêt, et comment la connectivité des différentes régions est modulée dans les conditions de stimulation différentes. Nos résultats sont en faveur du mode sériel de traitement de l’information somatosensorielle nociceptive avec un apport prédominant de la voie thalamocorticale vers S1 controlatérale au site de stimulation. Nos résultats impliquent que l'information se propage de S1 controlatéral à travers notre réseau d'intérêt composé des cortex S1 bilatéraux et S2. Notre analyse indique que la connexion S1→S2 est renforcée par la douleur, ce qui suggère que S2 est plus élevé dans la hiérarchie du traitement de la douleur que S1, conformément aux conclusions précédentes neurophysiologiques et de magnétoencéphalographie. Enfin, notre analyse fournit des preuves de l'entrée de l'information somatosensorielle dans l'hémisphère controlatéral au côté de stimulation, avec des connexions inter-hémisphériques responsable du transfert de l'information à l'hémisphère ipsilatéral.