977 resultados para promoter hypermethylation
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^
Resumo:
TNF-α is a pleiotropic cytokine involved in normal homeostasis and plays a key role in defending the host from infection and malignancy. However when deregulated, TNF-α can lead to various disease states. Therefore, understanding the mechanisms by which TNF-α is regulated may aid in its control. In spite of the knowledge gained regarding the transcriptional regulation of TNF-α further characterization of specific TNF-α promoter elements remains to be elucidated. In particular, the T&barbelow;NF-α A&barbelow;P-1/C&barbelow;RE-like (TAC) element of the TNF-α promoter has been shown to be important in the regulation of TNF-α in lymphocytes. Activating transcription factor-2 (ATF-2) and c-Jun were shown to bind to and transactivate the TAC element However, the role of TAC and transcription factors ATF-2 and c-Jun in the regulation of TNF-α in monocytes is not as well characterized. Lipopolysaccharide (LPS), a potent activator of TNF-α in monocytes, provides a good model to study the involvement of TAC in TNF-α regulation. On the other hand, all-tram retinoic acid (ATRA), a physiological monocyte-differentiation agent, is unable to induce TNF-α protein release. ^ To delineate the functional role of TAC, we transfected the wildtype or the TAC deleted TNF-α promoter-CAT construct into THP-1 promonocytic cells before stimulating them with LPS. CAT activity was induced 17-fold with the wildtype TNF-α promoter, whereas the CAT activity was uninducible when the TAC deletion mutant was used. This daft suggests that TAC is vital for LPS to activate the TNF-α promoter. Electrophoretic mobility shift assays using the TAC element as a probe showed a unique pattern for LPS-activated cells: the disappearance of the upper band of a doublet seen in untreated and ATRA treated cells. Supershift analysis identified c-Jun and ATF-2 as components of the LPS-stimulated binding complex. Transient transfection studies using dominant negative mutants of JNK, c-Jun, or ATF-2 suggest that these proteins we important for LPS to activate the TNF-α promoter. Furthermore, an increase in phosphorylated or activated c-Jun was bound to the TAC element in LPS-stimulated cells. Increased c-Jun activation was correlated with increased activity of Jun N-terminal kinase (JNK), a known upstream stimulator of c-Jun and ATF-2, in LPS-stimulated monocytes. On the other hand, ATRA did not induce TNF-α protein release nor changes in the phosphorylation of c-Jun or JNK activity, suggesting that pathways leading to ATRA differentiation of monocytic cells are independent of TNF-α activation. Together, the induction of TNF-α gene expression seems to require JNK activation, and activated c-Jun binding to the TAC element of the TNF-α promoter in THP-1 promonocytic cells. ^
Resumo:
Animal models and human functional imaging data implicate the dopamine system in mediating enhanced encoding of novel stimuli into human memory. A separate line of investigation suggests an association between a functional polymorphism in the promoter region for the human dopamine 4 receptor gene (DRD4) and sensitivity to novelty. We demonstrate, in two independent samples, that the -521Cmayor queT DRD4 promoter polymorphism determines the magnitude of human memory enhancement for contextually novel, perceptual oddball stimuli in an allele dose-dependent manner. The genotype-dependent memory enhancement conferred by the C allele is associated with increased neuronal responses during successful encoding of perceptual oddballs in the ventral striatum, an effect which is again allele dose-dependent. Furthermore, with repeated presentations of oddball stimuli, this memory advantage decreases, an effect mirrored by adaptation of activation in the hippocampus and substantia nigra/ventral tegmental area in C carriers only. Thus, a dynamic modulation of human memory enhancement for perceptually salient stimuli is associated with activation of a dopaminergic-hippocampal system, which is critically dependent on a functional polymorphism in the DRD4 promoter region.
Resumo:
The cell cycle inhibitor p21/WAF1/Cip1 is expressed in many cell types and is regulated by p53-dependent and p53-independent mechanisms. p21 is an important regulator of hepatocyte cell cycle, differentiation, and liver development, but little is known about the regulation of its synthesis in hepatocytes. We report herein that the p21 gene is constitutively expressed in human hepatoma HepG2 cells. Deletion analysis of the p21 promoter showed that it contains a distal (positions −2,300/−210) and a proximal (positions −124 to −61) region that act synergistically to achieve high levels of constitutive expression. The proximal region that consists of multiple Sp1 binding sites is essential for constitutive p21 promoter activity in hepatocytes. This region also mediates the transcriptional activation of the p21 promoter by members of the Smad family of proteins, which play important role in the transduction of extracellular signals such as transforming growth factor β, activin, etc. Constitutive expression of p21 was severely reduced by a C-terminally truncated form of Smad4 that was shown previously to block signaling through Smads. Smad3/4 and to a much lesser extent Smad2/4 caused high levels of transcriptional activation of the p21 promoter. Transactivation was compromised by N- or C-terminally truncated forms of Smad3. By using Gal4-Sp1 fusion proteins, we show that Smad proteins can activate gene transcription via functional interactions with the ubiquitous factor Sp1. These data demonstrate that Smad proteins and Sp1 participate in the constitutive or inducible expression of the p21 gene in hepatic cells.
Resumo:
To investigate the regulation of the human fatty acid synthase gene by the thyroid hormone triiodothyronine, various constructs of the human fatty acid synthase promoter and the luciferase reporter gene were transfected in combination with plasmids expressing the thyroid hormone and the retinoid X receptors in HepG2 cells. The reporter gene was activated 25-fold by the thyroid hormone in the presence of the thyroid hormone receptor. When both the thyroid hormone and the retinoid X receptors were expressed in HepG2 cells, there was about a 100-fold increase in reporter gene expression. 5′-Deletion analysis disclosed two thyroid hormone response elements, TRE1 (nucleotides −870 to −650) and TRE2 (nucleotides −272 to −40), in the human fatty acid synthase promoter. The presence of thyroid hormone response elements in these two regions of the promoter was confirmed by cloning various fragments of these two regions in the minimal thymidine kinase promoter−luciferase reporter gene plasmid construct and determining reporter gene expression. The results of this cloning procedure and those of electrophoretic mobility shift assays indicated that the sequence GGGTTAcgtcCGGTCA (nucleotides −716 to −731) represents TRE1 and that the sequence GGGTCC (nucleotides −117 to −112) represents TRE2. The sequence of TRE1 is very similar to the consensus sequence of the thyroid hormone response element, whereas the sequence of TRE2 contains only a half-site of the thyroid hormone response element consensus motif because it lacks the direct repeat. The sequences on either side of TRE2 seem to influence its response to the thyroid hormone and retinoid X receptors.
Targeting a SWI/SNF-related chromatin remodeling complex to the β-globin promoter in erythroid cells
Resumo:
Chromatin remodeling complexes such as the SWI/SNF complex make DNA accessible to transcription factors by disrupting nucleosomes. However, it is not known how such complexes are targeted to the promoter. For example, a SWI/SNF1-like chromatin remodeling complex erythroid Krüppel-like factor (EKLF) coactivator-remodeling complex 1 (E-RC1) disrupts the nucleosomes over the human β-globin promoter in an EKLF-dependent manner. However, it is not known whether E-RC1 is targeted specifically to the β-globin promoter or whether E-RC1 is randomly targeted, but its activity is evident only at the β-globin promoter. Because E-RC1 cannot remodel chromatin over the β-globin promoter without EKLF in vitro, it has been proposed that SWI/SNF1-like complexes such as E-RC1 are targeted specifically to the promoter by selectively interacting with promoter-associated transcription factors such as EKLF. In this report, we test this hypothesis in the cellular context by using the ProteIN POsition Identification with Nuclease Tail (PIN*POINT) assay. We find that the Brahma-related gene (BRG) 1 and BRG1-associated factor (BAF) 170 subunits of E-RC1 are both recruited near the transcription initiation site of the β-globin promoter. On transiently transfected templates, both the locus control region and the EKLF-binding site are important for their recruitment to the β-globin promoter in mouse erythroleukemia cells. When the β-globin promoter was linked to the cytomegalovirus enhancer, the E-RC1 complex was not recruited, suggesting that recruitment of the E-RC1 complex is not a general property of enhancers.
Resumo:
In Azotobacter vinelandii, deletion of the fdxA gene that encodes a well characterized seven-iron ferredoxin (FdI) is known to lead to overexpression of the FdI redox partner, NADPH:ferredoxin reductase (FPR). Previous studies have established that this is an oxidative stress response in which the fpr gene is transcriptionally activated to the same extent in response to either addition of the superoxide propagator paraquat to the cells or to fdxA deletion. In both cases, the activation occurs through a specific DNA sequence located upstream of the fpr gene. Here, we report the identification of the A. vinelandii protein that binds specifically to the paraquat activatable fpr promoter region as the E1 subunit of the pyruvate dehydrogenase complex (PDHE1), a central enzyme in aerobic respiration. Sequence analysis shows that PDHE1, which was not previously suspected to be a DNA-binding protein, has a helix–turn–helix motif. The data presented here further show that FdI binds specifically to the DNA-bound PDHE1.
Resumo:
We have studied the kinetics of transcriptional initiation and activation at the malT and malTp1 promoters of Escherichia coli using UV laser footprinting. Contrary to previous studies and because of the very rapid signal acquisition by this technique, we can obtain structural information about true reaction intermediates of transcription initiation. The consequences of adding a transcriptional activator, the cAMP receptor protein/cAMP complex (CRP), are monitored in real time, permitting us to assign specific interactions to the activation of discrete steps in transcription initiation. Direct protein–protein contacts between CRP and the RNA polymerase appeared very rapidly, followed by DNA melting around the −10 hexamer. CRP slightly increased the rate of this isomerization reaction but, more importantly, favored the establishment of additional contacts between the DNA upstream of the CRP binding site and RNA polymerase subsequent to open complex formation. These contacts make a major contribution to transcriptional activation by stabilizing open forms of the promoter complex, thereby indirectly accelerating promoter escape. The ensemble of the kinetic, structural signals demonstrated directly that CRP exerts most of its activating effects on the late stages of transcriptional initiation at the malT promoter.
Resumo:
Aberrant DNA methylation is a common phenomenon in human cancer, but its patterns, causes, and consequences are poorly defined. Promoter methylation of the DNA mismatch repair gene MutL homologue (MLH1) has been implicated in the subset of colorectal cancers that shows microsatellite instability (MSI). The present analysis of four MspI/HpaII sites at the MLH1 promoter region in a series of 89 sporadic colorectal cancers revealed two main methylation patterns that closely correlated with the MSI status of the tumors. These sites were hypermethylated in tumor tissue relative to normal mucosa in most MSI(+) cases (31/51, 61%). By contrast, in the majority of MSI(−) cases (20/38, 53%) the same sites showed methylation in normal mucosa and hypomethylation in tumor tissue. Hypermethylation displayed a direct correlation with increasing age and proximal location in the bowel and was accompanied by immunohistochemically documented loss of MLH1 protein both in tumors and in normal tissue. Similar patterns of methylation were observed in the promoter region of the calcitonin gene that does not have a known functional role in tumorigenesis. We propose a model of carcinogenesis where different epigenetic phenotypes distinguish the colonic mucosa in individuals who develop MSI(+) and MSI(−) tumors. These phenotypes may underlie the different developmental pathways that are known to occur in these tumors.
Resumo:
To study RAG2 gene regulation in vivo, we developed a blastocyst complementation method in which RAG2-deficient embryonic stem cells were transfected with genomic clones containing RAG2 and then assessed for their ability to generate lymphocytes. A RAG2 genomic clone that contained only the RAG2 promoter sequences rescued V(D)J recombination in RAG2-deficient pro-B cell lines, but did not rescue development of RAG2-deficient lymphocytes in vivo. However, inclusion of varying lengths of sequences 5′ of the RAG2 promoter generated constructs capable of rescuing only in vivo B cell development, as well as other constructs that rescued both B and T cell development. In particular, the 2-kb 5′ region starting just upstream of the RAG2 promoter, as well as the region from 2–7 kb 5′, could independently drive B cell development, but not efficient T cell development. Deletion of the 2-kb 5′ region from the murine germ line demonstrated that this region was not required for RAG expression sufficient to generate normal B or T cell numbers, implying redundancy among 5′ elements. We conclude that RAG2 expression in vivo requires elements beyond the core promoter, that such elements contribute to differential regulation in the B vs. T lineages, and that sequences sufficient to direct B cell expression are located in the promoter-proximal 5′ region.
Resumo:
We have developed a technique, methylation-specific PCR in situ hybridization (MSP-ISH), which allows for the methylation status of specific DNA sequences to be visualized in individual cells. We use MSP-ISH to monitor the timing and consequences of aberrant hypermethylation of the p16 tumor suppresser gene during the progression of cancers of the lung and cervix. Hypermethylation of p16 was localized only to the neoplastic cells in both in situ lesions and invasive cancers, and was associated with loss of p16 protein expression. MSP-ISH allowed us to dissect the surprising finding that p16 hypermethylation occurs in cervical carcinoma. This tumor is associated with infection of the oncogenic human papillomavirus, which expresses a protein, E7, that inactivates the retinoblastoma (Rb) protein. Thus, simultaneous Rb and p16 inactivation would not be needed to abrogate the critical cyclin D–Rb pathway. MSP-ISH reveals that p16 hypermethylation occurs heterogeneously within early cervical tumor cell populations that are separate from those expressing viral E7 transcripts. In advanced cervical cancers, the majority of cells have a hypermethylated p16, lack p16 protein, but no longer express E7. These data suggest that p16 inactivation is selected as the most effective mechanism of blocking the cyclin D–Rb pathway during the evolution of an invasive cancer from precursor lesions. These studies demonstrate that MSP-ISH is a powerful approach for studying the dynamics of aberrant methylation of critical tumor suppressor genes during tumor evolution.
Resumo:
Entamoeba histolytica is a single cell eukaryote that is the etiologic agent of amoebic colitis. Core promoter elements of E. histolytica protein encoding genes include a TATA-like sequence (GTATTTAAAG/C) at −30, a novel element designated GAAC (GAACT) that has a variable location between TATA and the site of transcription initiation, and a putative initiator (Inr) element (AAAAATTCA) overlying the site of transcription initiation. The presence of three separate conserved sequences in a eukaryotic core promoter is unprecedented and prompted examination of their roles in regulating transcription initiation. Alterations of all three regions in the hgl5 gene decreased reporter gene activity with the greatest effect seen by mutation of the GAAC element. Positional analysis of the TATA box demonstrated that transcription initiated consistently 30–31 bases downstream of the TATA region. Mutation of either the TATA or GAAC elements resulted in the appearance of new transcription start sites upstream of +1 in the promoter of the hgl5 gene. Mutation of the Inr element resulted in no change in the site of transcription initiation; however, in the presence of a mutated TATA and GAAC regions, the Inr element controlled the site of transcription initiation. We conclude that all three elements play a role in determining the site of transcription initiation. The variable position of the GAAC element relative to the site of transcription initiation, and the multiple transcription initiations that resulted from its mutation, indicate that the GAAC element has an important and apparently novel role in transcriptional control in E. histolytica.
Resumo:
We previously demonstrated that α1B-adrenergic receptor (AR) gene transcription, mRNA, and functionally coupled receptors increase during 3% O2 exposure in aorta, but not in vena cava smooth muscle cells (SMC). We report here that α1BAR mRNA also increases during hypoxia in liver and lung, but not heart and kidney. A single 2.7-kb α1BAR mRNA was detected in aorta and vena cava during normoxia and hypoxia. The α1BAR 5′ flanking region was sequenced to −2,460 (relative to ATG +1). Transient transfection experiments identify the minimal promoter region between −270 and −143 and sequence between −270 and −248 that are required for transcription of the α1BAR gene in aorta and vena cava SMC during normoxia and hypoxia. An ATTAAA motif within this sequence specifically binds aorta, vena cava, and DDT1MF-2 nuclear proteins, and transcription primarily initiates downstream of this motif at approximately −160 in aorta SMC. Sequence between −837 and −273 conferred strong hypoxic induction of transcription in aorta, but not in vena cava SMC, whereas the cis-element for the transcription factor, hypoxia-inducible factor 1, conferred hypoxia-induced transcription in both aorta and vena cava SMC. These data identify sequence required for transcription of the α1BAR gene in vascular SMC and suggest the atypical TATA-box, ATTAAA, may mediate this transcription. Hypoxia-sensitive regions of the α1BAR gene also were identified that may confer the differential hypoxic increase in α1BAR gene transcription in aorta, but not in vena cava SMC.
Resumo:
The gene encoding the mouse vitamin D receptor has been cloned. A new exon 1 has been found that changes the numbering established for the human VDR gene. Exons 2 and 3 in the human VDR gene (coding for the zinc fingers 1 and 2, respectively) are named exons 3 and 4 in the mouse vitamin D receptor. The 1.5-kb 5′-flanking region of the new exon 1 was analyzed and revealed the presence of putative cis-acting elements. Despite the absence of a TATA box, this 5′-flanking region contains several characteristics of a GC-rich promoter including four Sp1 sites present in tandem and two CCAAT boxes. Interestingly, the Sp1 site that is the most proximal to the new exon 1 overlaps a perfect site for Krox-20/24. Krox-20 is a transcription factor involved in brain development, and also in bone remodeling. In luciferase reporter gene expression assays, we showed that sequences from this 5′-flanking region elicit high transactivation activity. Furthermore, in the NIH 3T3 cell line, a 3- to 5-fold increase in response to forskolin treatment (an activator of adenylate cyclase and in turn of protein kinase A pathway) was observed.