979 resultados para frequency response function


Relevância:

40.00% 40.00%

Publicador:

Resumo:

The purpose of this research is to explore the variability on the soil thermal conductivity -λ- after a prescribe fire, and to assess the effects of the ashes on the heat transfer once it"s were incorporated into the soil matrix. Sampling plot was located in the Montgrí Massif (NE of Spain). A set of 42 soil samples between surface and 5 cm depth was collected before and after the fire. To characterize the soil chemical and physical variables were analyzed. To determine the vari-ability on the soil λ a dry-out curve per scenario (before and after fire) was determined. SoilRho® method based on ASTM D-5334-08 which was validated by LabFerrer was used. Soil thermal conductivity has shown changes in their values. Indeed, in all moisture scenarios the values of soil λ decreased after soil was burnt. The critical point in the rela-tionship ϴ (λ) for the soil after fire which always was stronger than soil before to be burnt. Soil with"white" ashes showed a high thermal conductivity. An X-Ray diffractometry analysis allowed to clarify and to verify these results. To sum up, we could say that thermal conductivity presents changes when the scenario changes, i.e. before and after to be burnt. On the other hand, the volume of ashes incorporated on the soil increased the differences between no burnt and burnt soil, showing even some improvements on the heat transfer when water content started to govern the process.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The purpose of this study was to evaluate the efficiency of integrated managements on white mold control on common bean. Initially, in vitro testing was made to assess the antagonism of 11 Trichoderma isolates against Sclerotinia sclerotiorum and to investigate fungicides (fluazinam and procymidone) inhibitory effects on those fungi. In two field experiments the following combinations were tested: irrigation frequencies (seven or 14 days), plant densities (six or 12 plants per meter), and three disease controls (untreated control, fungicide or Trichoderma spp.). In a third experiment plant densities were replaced by grass mulching treatments (with or without mulching). Fluazinam was applied at 45 and 55 days after emergence (DAE). The antagonists T. harzianum (experiments 1 and 3) and T. stromatica (experiment 2) were applied through sprinkler irrigation at 10 and 25 DAE, respectively. Most of the Trichoderma spp. were effective against the pathogen in vitro. Fluazinam was more toxic than procymidone to both the pathogen and the antagonist. Fungicide applications increased yield between 32 % and 41 %. In field one application of Trichoderma spp. did not reduce disease intensity and did not increase yield. The reduction from 12 to six plants per meter did not decrease yield, and disease severity diminished in one of the two experiments. It is concluded that of the strategies for white mold control just reduction of plant density and applications of fungicide were efficient.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objective of the present study was to determine contrast sensitivity curves of concentric circular patterns with radial frequencies of 0.25, 0.5, 1.0, 2.0, and 4.0 cycles per degree in young and older adult volunteers. These parameters were also compared with sensitivity contrasts for sine-wave gratings. All participants had normal acuity vision and were free of identifiable ocular illness. Contrast sensitivity was measured in 6 young adults aged 19 to 23 years and 6 older adults aged 60 to 69 years using the psychophysical forced-choice method. In this paradigm the volunteers had to decide which of two stimuli contained the above radial frequencies at low contrast levels. The other neutral stimulus was gray with homogeneous luminance. We detected a decline in contrast sensitivity for older adults at all radial frequencies compared to young adults. Also, contrast sensitivity for sine-wave gratings at all measured frequencies was better, as predicted, for all young adults. Maximum sensitivities in the radial frequency contrast sensitivity function and contrast sensitivity function occurred at 0.25 and 0.5 cycles per degree, respectively, for both young and older adults. These results suggest age-related changes in the contrast sensitivity function for concentric symmetrical stimuli.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Patients with heart failure who have undergone partial left ventriculotomy improve resting left ventricular systolic function, but have limited functional capacity. We studied systolic and diastolic left ventricular function at rest and during submaximal exercise in patients with previous partial left ventriculotomy and in patients with heart failure who had not been operated, matched for maximal and submaximal exercise capacity. Nine patients with heart failure previously submitted to partial left ventriculotomy were compared with 9 patients with heart failure who had not been operated. All patients performed a cardiopulmonary exercise test with measurement of peak oxygen uptake and anaerobic threshold. Radionuclide left ventriculography was performed to analyze ejection fraction and peak filling rate at rest and during exercise at the intensity corresponding to the anaerobic threshold. Groups presented similar exercise capacity evaluated by peak oxygen uptake and at anaerobic threshold. Maximal heart rate was lower in the partial ventriculotomy group compared to the heart failure group (119 ± 20 vs 149 ± 21 bpm; P < 0.05). Ejection fraction at rest was higher in the partial ventriculotomy group as compared to the heart failure group (41 ± 12 vs 32 ± 9%; P < 0.0125); however, ejection fraction increased from rest to anaerobic threshold only in the heart failure group (partial ventriculotomy = 44 ± 17%; P = non-significant vs rest; heart failure = 39 ± 11%; P < 0.0125 vs rest; P < 0.0125 vs change in the partial ventriculotomy group). Peak filling rate was similar at rest and increased similarly in both groups at the anaerobic threshold intensity (partial ventriculotomy = 2.28 ± 0.55 EDV/s; heart failure = 2.52 ± 1.07 EDV/s; P < 0.0125; P > 0.05 vs change in partial ventriculotomy group). The abnormal responses demonstrated here may contribute to the limited exercise capacity of patients with partial left ventriculotomy despite the improvement in resting left ventricular systolic function.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Upper gastrointestinal endoscopy is often accompanied by tachycardia which is known to be an important pathogenic factor in the development of myocardial ischemia. The pathogenesis of tachycardia is unknown but the condition is thought to be due to the endocrine response to endoscopy. The purpose of the present study was to investigate the effects of sedation on the endocrine response and cardiorespiratory function. Forty patients scheduled for diagnostic upper gastrointestinal endoscopy were randomized into 2 groups. While the patients in the first group did not receive sedation during upper gastrointestinal endoscopy, the patients in the second group were sedated with intravenous midazolam at the dose of 5 mg for those under 65 years or 2.5 mg for those aged 65 years or more. Midazolam was administered by slow infusion. In both groups, blood pressure, ECG tracing, heart rate, and peripheral oxygen saturation (SpO2) were monitored during endoscopy. In addition, blood samples for the determination of cortisol, glucose and C-reactive protein levels were obtained from patients in both groups prior to and following endoscopy. Heart rate and systolic arterial pressure changes were within normal limits in both groups. Comparison of the two groups regarding the values of these two parameters did not reveal a significant difference, while a statistically significant reduction in SpO2 was found in the sedation group. No significant differences in serum cortisol, glucose or C-reactive protein levels were observed between the sedated and non-sedated group. Sedation with midazolam did not reduce the endocrine response and the tachycardia developing during upper gastrointestinal endoscopy, but increased the reduction in SpO2.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Endothelial function (EF) plays an important role in the onset and clinical course of atherosclerosis, although its relationship with the presence and extent of coronary artery disease (CAD) has not been well defined. We evaluated EF and the ST segment response to an exercise test in patients with a broad spectrum of CAD defined by coronary angiography. Sixty-two patients submitted to diagnostic catheterization for the evaluation of chest pain or ischemia in a provocative test were divided into three groups according to the presence and severity of atherosclerotic lesions (AL): group 1: normal coronaries (N = 19); group 2: CAD with AL <70% (N = 17); group 3: CAD with AL ≥70% (N = 26). EF was evaluated by the percentage of flow-mediated dilatation (%FMD) in the brachial artery during reactive hyperemia induced by occlusion of the forearm with a pneumatic cuff for 5 min. Fifty-four patients were subjected to an exercise test. Gender and age were not significantly correlated with %FMD. EF was markedly reduced in both groups with CAD (76.5 and 73.1% vs 31.6% in group 1) and a higher frequency of ischemic alterations in the ST segment (70.8%) was observed in the group with obstructive CAD with AL ≥70% during the exercise test. Endothelial dysfunction was observed in patients with CAD, irrespective of the severity of injury. A significantly higher frequency of ischemic alterations in the ST segment was observed in the group with obstructive CAD. EF and exercise ECG differed among the three groups and may provide complementary information for the assessment of CAD.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

There is a paucity of studies comparing social buffering in adolescents and adults, despite their marked differences in social behaviour. I investigated whether greater effects of social buffering on plasma corticosterone concentrations and expression of Zif268 in neural regions after an acute stressor would be found in adolescent compared with adult rats. Samples were obtained before and after one hour of isolation stress and after either one or three hours of recovery back in the colony with either a familiar or unfamiliar cage partner. Adolescent and adult rats did not differ in plasma concentrations of corticosterone at any time point. Corticosterone concentrations were higher after one hour isolation than at baseline (p < 0.001), and rats with a familiar partner during the recovery phase had lower corticosterone concentrations than did rats with an unfamiliar partner (p = 0.02). Zif268 immunoreactive cell counts were higher in the arcuate nucleus in both age groups after isolation (p = 0.007) and higher in the paraventricular nucleus of adolescents compared with adults during the recovery phase irrespective of partner familiarity. There was a significant decrease in immunoreactive cell counts after one hour isolation compared to baseline in the basolateral amygdala, central nucleus of the amygdala, and in the pyramidal layer of the hippocampus (all p < 0.05). An effect of partner familiarity on Zif268 immunoreactive cell counts was found in the granule layer of the dentate gyrus irrespective of age (higher in those with a familiar partner, p = 0.03) and in the medial prefrontal cortex in adolescents (higher with an unfamiliar partner, p = 0.02). Overall, the acute stress and partner familiarity produced a similar pattern of results in adolescents and adults, with both age groups sensitive to the social context.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The attached file is created with Scientific Workplace Latex

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The longitudinal dipole response of a quantum dot has been calculated in the far-infrared regime using local-spin-density-functional theory. We have studied the coupling between the collective spin and density modes as a function of the magnetic field. We have found that the spin dipole mode and single-particle excitations have a sizable overlap, and that the magnetoplasmon modes can be excited by the dipole spin operator if the dot is spin polarized. The frequency of the dipole spin edge mode presents an oscillation which is clearly filling factor (v) related. We have found that the spin dipole mode is especially soft for even-n values. Results for selected numbers of electrons and confining potentials are discussed.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Hypothesis: The aim of this study was to measure the mass loading effect of an active middle-ear implant (the Vibrant Soundbridge) in cadaver temporal bones. Background: Implantable middle ear hearing devices such as Vibrant Soundbridge have been used as an alternative to conventional hearing aids for the rehabilitation of sensorineural hearing loss. Other than the obvious disadvantage of requiring implantation middle ear surgery, it also applies a direct weight on the ossicular chain which, in turn, may have an impact on residual hearing. Previous studies have shown that applying a mass directly on the ossicular chain has a damping effect on its response to sound. However, little has been done to investigate the magnitude and the frequency characteristics of the mass loading effect in devices such as the Vibrant Soundbridge. Methods: Five fresh cadaver temporal bones were used. The stapes displacement was measured using laser Doppler vibrometry before and after the placement of a Vibrant Sound-bridge floating mass transducer. The effects of mass and attachment site were compared with the unloaded response. Measurements were obtained at frequencies between 0.1 and 10 kHz and at acoustic input levels of 100 dB sound pressure level. Each temporal bone acted as its own control. Results: Placement of the floating mass transducer caused a reduction of the stapes displacement. There were variations between the bones. The change of the stapes displacement varied from 0 dB to 28 dB. The effect was more prominent at frequencies above 1,000 Hz. Placing the floating mass transducer close to the incudostapedial joint reduced the mass loading effect. Conclusion: The floating mass transducer produces a measurable reduction of the stapes displacement in the temporal bone model. The effect is more prominent at high frequencies.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The climate belongs to the class of non-equilibrium forced and dissipative systems, for which most results of quasi-equilibrium statistical mechanics, including the fluctuation-dissipation theorem, do not apply. In this paper we show for the first time how the Ruelle linear response theory, developed for studying rigorously the impact of perturbations on general observables of non-equilibrium statistical mechanical systems, can be applied with great success to analyze the climatic response to general forcings. The crucial value of the Ruelle theory lies in the fact that it allows to compute the response of the system in terms of expectation values of explicit and computable functions of the phase space averaged over the invariant measure of the unperturbed state. We choose as test bed a classical version of the Lorenz 96 model, which, in spite of its simplicity, has a well-recognized prototypical value as it is a spatially extended one-dimensional model and presents the basic ingredients, such as dissipation, advection and the presence of an external forcing, of the actual atmosphere. We recapitulate the main aspects of the general response theory and propose some new general results. We then analyze the frequency dependence of the response of both local and global observables to perturbations having localized as well as global spatial patterns. We derive analytically several properties of the corresponding susceptibilities, such as asymptotic behavior, validity of Kramers-Kronig relations, and sum rules, whose main ingredient is the causality principle. We show that all the coefficients of the leading asymptotic expansions as well as the integral constraints can be written as linear function of parameters that describe the unperturbed properties of the system, such as its average energy. Some newly obtained empirical closure equations for such parameters allow to define such properties as an explicit function of the unperturbed forcing parameter alone for a general class of chaotic Lorenz 96 models. We then verify the theoretical predictions from the outputs of the simulations up to a high degree of precision. The theory is used to explain differences in the response of local and global observables, to define the intensive properties of the system, which do not depend on the spatial resolution of the Lorenz 96 model, and to generalize the concept of climate sensitivity to all time scales. We also show how to reconstruct the linear Green function, which maps perturbations of general time patterns into changes in the expectation value of the considered observable for finite as well as infinite time. Finally, we propose a simple yet general methodology to study general Climate Change problems on virtually any time scale by resorting to only well selected simulations, and by taking full advantage of ensemble methods. The specific case of globally averaged surface temperature response to a general pattern of change of the CO2 concentration is discussed. We believe that the proposed approach may constitute a mathematically rigorous and practically very effective way to approach the problem of climate sensitivity, climate prediction, and climate change from a radically new perspective.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Using the formalism of the Ruelle response theory, we study how the invariant measure of an Axiom A dynamical system changes as a result of adding noise, and describe how the stochastic perturbation can be used to explore the properties of the underlying deterministic dynamics. We first find the expression for the change in the expectation value of a general observable when a white noise forcing is introduced in the system, both in the additive and in the multiplicative case. We also show that the difference between the expectation value of the power spectrum of an observable in the stochastically perturbed case and of the same observable in the unperturbed case is equal to the variance of the noise times the square of the modulus of the linear susceptibility describing the frequency-dependent response of the system to perturbations with the same spatial patterns as the considered stochastic forcing. This provides a conceptual bridge between the change in the fluctuation properties of the system due to the presence of noise and the response of the unperturbed system to deterministic forcings. Using Kramers-Kronig theory, it is then possible to derive the real and imaginary part of the susceptibility and thus deduce the Green function of the system for any desired observable. We then extend our results to rather general patterns of random forcing, from the case of several white noise forcings, to noise terms with memory, up to the case of a space-time random field. Explicit formulas are provided for each relevant case analysed. As a general result, we find, using an argument of positive-definiteness, that the power spectrum of the stochastically perturbed system is larger at all frequencies than the power spectrum of the unperturbed system. We provide an example of application of our results by considering the spatially extended chaotic Lorenz 96 model. These results clarify the property of stochastic stability of SRB measures in Axiom A flows, provide tools for analysing stochastic parameterisations and related closure ansatz to be implemented in modelling studies, and introduce new ways to study the response of a system to external perturbations. Taking into account the chaotic hypothesis, we expect that our results have practical relevance for a more general class of system than those belonging to Axiom A.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A common procedure for studying the effects on cognition of repetitive transcranial magnetic stimulation (rTMS) is to deliver rTMS concurrent with task performance, and to compare task performance on these trials versus on trials without rTMS. Recent evidence that TMS can have effects on neural activity that persist longer than the experimental session itself, however, raise questions about the assumption of the transient nature of rTMS that underlies many concurrent (or "online") rTMS designs. To our knowledge, there have been no studies in the cognitive domain examining whether the application of brief trains of rTMS during specific epochs of a complex task may have effects that spill over into subsequent task epochs, and perhaps into subsequent trials. We looked for possible immediate spill-over and longer-term cumulative effects of rTMS in data from two studies of visual short-term delayed recognition. In 54 subjects, 10-Hz rTMS trains were applied to five different brain regions during the 3-s delay period of a spatial task, and in a second group of 15 subjects, electroencephalography (EEG) was recorded while 10-Hz rTMS was applied to two brain areas during the 3-s delay period of both spatial and object tasks. No evidence for immediate effects was found in the comparison of the memory probe-evoked response on trials that were vs. were not preceded by delay-period rTMS. No evidence for cumulative effects was found in analyses of behavioral performance, and of EEG signal, as a function of task block. The implications of these findings, and their relation to the broader literature on acute vs. long-lasting effects of rTMS, are considered.