The role of plasmacytoid dendritic cells in the regulation of adaptive immunity

Plasmacytoid dendritic cells (pDCs) selectively express TLR7 which allows them to respond to RNA viruses and TLR9 which allows them to respond to DNA viruses and CpG oligonucleotides. Upon exposure to virus pDCs produce vast amounts of type I interferon (IFN) directly inhibiting viral replication and contributing to the activation of other immune cells. The ability of pDCs to promote B and T cell differentiation through type I IFN has been well documented although the role of additional factors including tumor necrosis factor (TNF) family members has not been thoroughly addressed. Here the expression of selected TNF family members in pDCs was examined and the role of TNF receptor-ligand interactions in the regulation of B and T lymphocyte growth and differentiation by pDCs was investigated. Upon stimulation with CpG-B, pDCs exhibit strong and stable expression of CD70, a TNF family ligand that binds to its receptor CD27 on memory B cells and promotes plasma cell differentiation and Ig secretion. Using an in vitro pDC/B cell co-culture system, it was determined that CpG-B-stimulated pDCs induce the proliferation of CD40L-activated human peripheral B cells and Ig secretion. This occurs independently of IFN and residual CpG, and requires physical contact between pDCs and B cells. CpG-stimulated pDCs induce the proliferation of both naive and memory B cells although Ig secretion is restricted to the memory subset. Blocking the interaction of CD70 with CD27 using an antagonist anti-CD70 antibody reduces the induction of B cell proliferation and IgG secretion by CpG-B-stimulated pDCs. Published studies have also indicated an important role for CD70 in promoting the expansion of CD4+ and CD8+ T cells and the development of effector function. CpG-B-stimulated pDCs induce naïve CD4+ T cell proliferation and production of multiple cytokines including IFN-γ, TNF-α, IL-10, IL-4, IL-5 and IL-13. Blocking the function of CD70 with an antagonist anti-CD70 antibody significantly reduced the induction of naïve CD4+ T cell proliferation by CpG-B-stimulated pDCs and the production of IL-4 and IL-13. Collectively these data indicate an important role for CD70 in the regulation of B and T lymphocyte growth and differentiation by pDCs. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

G -rich oligodeoxyribonucleotides: Triplexes and transcription

Formation of a triple helix resulting from oligonucleotide binding to the DNA double helix offers new possibilities to control gene expression at the transcriptional level. Purine-motif triplexes can be formed under physiological pH. Nevertheless, this formation was inhibited by certain monovalent cations during the association but not during dissociation. Since triplexes are very stable, it was possible to assemble them in the absence of KCl and have them survive throughout the course of an in vitro transcription reaction. As for the design of a better triplex-forming oligonucleotide, 12 nucleotides in length afforded the highest binding affinity. G/T-rich oligonucleotides can be very polymorphic in solution. The conditions for forming purine-motif triplexes, duplexes or G-quartets were determined. Understanding these parameters will be important for the practical use of G-rich oligonucleotides in the development of DNA aptamers where the structure of the oligonucleotide is paramount in dictating its function. Finally, purine-motif triplexes were demonstrated to significantly inhibit gene transcription in vitro. The optimal effect on this process was dependent on the location of triplexes within the promoter, i.e., whether upstream or proximally downstream of the transcription start site. The mechanism for the inhibition of transcription appeared to be interference with initiation through preventing engagement by RNA polymerase. This finding is revolutionary when compared to the conventional model where triplexes inhibit transcription only by occluding binding by trans-acting proteins. Our findings broaden the utility of triplexes and support a strategy for antigene therapy by triplexes. ^

Role of janus tyrosine kinase -3 (JAK3) and signal transducer and activator of transcription (STAT5) pathway in T lymphocyte activation

T cell activation and expansion is essential for immune response against foreign antigens. However, uncontrolled T cell activity can be manifested as a number of lymphoid derived diseases such as autoimmunity, graft versus host disease, and lymphoma. The purpose of this research was to test the central hypothesis that the Jak3/Stat5 pathway is critical for T cell function. To accomplish this objective, two novel Jak3 inhibitors, AG490 and PNU156804, were identified and their effects characterized on Jak3/Stat5 activation and T cell growth. Inhibition of Jak3 selectively disrupted primary human T lymphocyte growth in response to Interleukin-2 (IL-2), as well as other γ c cytokine family members including IL-4, IL-7, IL-9, and IL-15. Inhibition of Jak3 ablated IL-2 induced Stat5 but not TNF-α mediated NF-κβ DNA binding. Loss of Jak3 activity did not affect T cell receptor mediated signals including activation of p56Lck and Zap70, or IL-2 receptor a chain expression. To examine the effects of Jak3/Stat5 inhibition within a mature immune system, we employed a rat heart allograft model of Lewis (RT1 1) to ACI (RT1a). Heart allograft survival was significantly prolonged following Jak3/Stat5 inhibition when rats were treated with AG490 (20mg/kg) or PNU156804 (80mg/kg) compared to non-treated control animals. This effect was synergistically potentiated when Jak3 inhibitors were used in combination with a signal 1/2 disrupter, cyclosporine, but only additively potentiated with another signal 3 inhibitor, rapamycin. This suggested that sequential inhibition of T cell function is more effective. To specifically address the role of Stat5 in maintaining T cell activity, novel Stat5 antisense oligonucleotides were synthesized and characterized in vitro. Primary human T cells and T-cell tumor lines treated with Stat5 antisense oligonucleotide (7.5 μM) rapidly underwent apoptosis, while no changes in cell cycle were observed as measured by FACS analysis utilizing Annexin-V-Fluorescein and Propidium iodide staining. Evidence is provided to suggest that caspase 8 and 9 pathways mediate this event. Thus, Stat5 may act rather as a negative regulator of apoptotic signals and not as a positive regulator of cell cycle as previously proposed. We conclude that the Jak3/Stat5 pathway is critical for γc cytokine mediated gene expression necessary for T cell expansion and normal immune function and represents an therapeutically relevant effector pathway to combat T cell derived disease. ^

Developmental functions of XKaiso, a transcriptional repressor associating with the p120 catenin in Xenopus laevis

The Armadillo family catenin proteins function in multiple capacities including cadherin-mediated cell-cell adhesion and nuclear signaling. The newest catenin, p120 catenin, differs from the classical catenins and binds to the membrane-proximal domain of cadherins. Recently, a novel transcription factor Kaiso was found to interact with p120 catenin, suggesting that p120 catenin also possesses a nuclear function. We isolated the Xenopus homolog of Kaiso, XKaiso, from a Xenopus stage 17 cDNA library. XKaiso contains an amino-terminal BTB/POZ domain and three carboxyl-terminal zinc fingers. The XKaiso transcript was present maternally and expressed throughout early embryonic development. XKaiso's spatial expression was defined via in situ hybridization and was found localized to the brain, eye, ear, branchial arches, and spinal cord. Co-immunoprecipitation of Xenopus p120 catenin and XKaiso demonstrated their mutual association, while related experiments employing differentially epitope-tagged XKaiso constructs suggest that XKaiso also self-associates. On the functional level, reporter assays employing a chimera of XKaiso fused to the GAL4 DNA binding domain indicated that XKaiso is a transcriptional repressor. To better understand the significance of the Kaiso-p120 catenin complex in vertebrate development, Kaiso knock-down experiments were undertaken, and the modulatory role of p120 catenin in Kaiso function examined during Xenopus development. Using morpholino antisense oligonucleotides to block translation of XKaiso, XKaiso was found to be essential for Xenopus gastrulation, being required for correct morphogenetic movements in early embryogenesis. Molecular marker analyses indicated that one target gene of the Wnt/β-catenin pathway, Siamois, is significantly increased in embryos depleted for XKaiso, while other dorsal, ventral, and mesodermal cell fate markers were unaltered. In addition, the non-canonical Wnt-11, known to participate in planar cell polarity/convergent extension processes, was significantly upregulated following depletion of XKaiso. Such increased Wnt-11 expression likely contributed to the XKaiso depletion phenotype because a dominant negative form of Wnt-11 or of the downstream effector Dishevelled partially rescued the observed gastrulation defects. These results show that XKaiso is essential for proper gastrulation movements, resulting at least in part from its modulation of non-canonical Wnt signaling. The significance of the XKaiso-p120 catenin interaction has yet to be determined, but appears to include a role in modulating genes promoting canonical and non-canonical Wnt signals. ^

Proceedings of the Twenty-Sixth Annual Biochemical Engineering Symposium

This volume contains the Proceedings of the Twenty-Sixth Annual Biochemical Engineering Symposium held at Kansas State University on September 21, 1996. The program included 10 oral presentations and 14 posters. Some of the papers describe the progress of ongoing projects, and others contain the results of completed projects. Only brief summaries are given of some of the papers; many of the papers will be published in full elsewhere. A listing of those who attended is given below. ContentsForeign Protein Production from SV40 Early Promoter in Continuous Cultures of Recombinant CHO Cells - Gautam Banik, Paul Todd, and Dhinakar Kampala Enhanced Cell Recruitment Due to Cell-Cell Interactions - Brad Farlow and Matthias Nollert The Recirculation of Hybridoma Suspension Cultures: Effects on Cell Death, Metabolism and Mab Productivity - Peng Jin and Carole A. Heath The Importance of Enzyme Inactivation and Self-Recovery in Cometabolic Biodegradation of Chlorinated Solvents - Xi-Hui Zhang, Shanka Banerji, and Rakesh Bajpai Phytoremediation of VOC contaminated Groundwater using Poplar Trees - Melissa Miller, Jason Dana, L.C. Davis, Murlidharan Narayanan, and L.E. Erickson Biological Treatment of Off-Gases from Aluminum Can Production: Experimental Results and Mathematical Modeling - Adeyma Y. Arroyo, Julio Zimbron, and Kenneth F. Reardon Inertial Migration Based Separation of Chlorella Microalgae in Branched Tubes - N.M. Poflee, A.L. Rakow, D.S. Dandy, M.L. Chappell, and M.N. Pons Contribution of Electrochemical Charge to Protein Partitioning in Aqueous Two-Phase Systems - Weiyu Fan and Charles C. Glatz Biodegradation of Some Commercial Surfactants Used in Bioremediation - Jun Gu, G.W. Preckshot, S.K. Banerji, and Rakesh Bajpai Modeling the Role of Biomass in Heavy Metal Transport Ln Vadose Zone - K.V. Nedunuri, L.E. Erickson, and R.S. Govindaraju Multivariable Statistical Methods for Monitoring Process Quality: Application to Bioinsecticide Production by 73 89 Bacillus Thuringiensis - c. Puente and M.N. Karim The Use of Polymeric Flocculants in Bacterial Lysate Streams - H. Graham, A.S. Cibulskas and E.H. Dunlop Effect of Water Content on transport of Trichloroethylene in a Chamber with Alfalfa Plants - Muralidharan Narayanan, Jiang Hu, Lawrence C. Davis, and Larry E. Erickson Detection of Specific Microorganisms using the Arbitrary Primed PCR in the Bacterial Community of Vegetated Soil - X. Wu and L.C. Davis Flux Enhancement Using Backpulsing - V.T. Kuberkar and R.H. Davis Chromatographic Purification of Oligonucleotides: Comparison with Electrophoresis - Stephen P. Cape, Ching-Yuan Lee, Kevin Petrini, Sean Foree, Micheal G. Sportiello and Paul Todd Determining Singular Arc Control Policies for Bioreactor Systems Using a Modified Iterative Dynamic Programming Algorithm - Arun Tholudur and W. Fred Ramirez Pressure Effect on Subtilisins Measured via FTIR, EPR and Activity Assays, and Its Impact on Crystallizations - J.N. Webb, R.Y. Waghmare, M.G. Bindewald, T.W. Randolph, J.F. Carpenter, C.E. Glatz Intercellular Calcium Changes in Endothelial Cells Exposed to Flow - Laura Worthen and Matthias Nollert Application of Liquid-Liquid Extraction in Propionic Acid Fermentation - Zhong Gu, Bonita A. Glatz, and Charles E. Glatz Purification of Recombinant T4 Lysozyme from E. Coli: Ion-Exchange Chromatography - Weiyu Fan, Matt L. Thatcher, and Charles E. Glatz Recovery and Purification of Recombinant Beta-Glucuronidase from Transgenic Corn - Ann R. Kusnadi, Roque Evangelista, Zivko L. Nikolov, and John Howard Effects of Auxins and cytokinins on Formation of Catharanthus Roseus G. Don Multiple Shoots - Ying-Jin Yuan, Yu-Min Yang, Tsung-Ting Hu, and Jiang Hu Fate and Effect of Trichloroethylene as Nonaqueous Phase Liquid in Chambers with Alfalfa - Qizhi Zhang, Brent Goplen, Sara Vanderhoof, Lawrence c. Davis, and Larry E. Erickson Oxygen Transport and Mixing Considerations for Microcarrier Culture of Mammalian Cells in an Airlift Reactor - Sridhar Sunderam, Frederick R. Souder, and Marylee Southard Effects of Cyclic Shear Stress on Mammalian Cells under Laminar Flow Conditions: Apparatus and Methods - M.L. Rigney, M.H. Liew, and M.Z. Southard

Proceedings of the Twenty-Fifth Annual Biochemical Engineering Symposium

The Annual Biochemical Engineering Symposium Series started in 1970 when Professors Larry E. Erickson (Kansas State University) and Peter J. Reilly (then with University of Nebraska-Lincoln) got together in Manhattan, KS along with their students for a half-day powwow and technical presentation by their students. Ever since then, it has been a forum for Biochemical Engineering students in the heartland of USA to present their research to their colleagues in the form of talks and posters. The institutions actively involved with this annual symposium include Colorado State University, Kansas State University, Iowa State University, University of Colorado, University of Kansas, University of Missouri-Columbia, and University of Oklahoma. The University of lowa and University of Nebraska-Lincoln have also participated in the conference in recent years. The host institutions for the different symposia have been: Kansas State University (1, 3, 5, 9, 12, 16, 20), Iowa State University (6, 7, 10, 13, 17, 22), University of Missouri-Columbia (8, 14, 19, 25), Colorado State University (II, 15, 21), University of Colorado (18, 24), University of Nebraska-Lincoln (2, 4), University of Oklahoma (23). The next symposium will be held at Kansas State University. Proceedings of the Symposium are edited by faculty of the host institution and include manuscripts written and submitted by the presenters (students). These often include works-in-progress and final publication usually takes place in refereed journals. ContentsPatrick C. Gilcrease and Vincent G. Murphy, Colorado State University. Use of 2,4,6-Trinitrotoluene (TNT) As A Nitrogen Source By A Pseudomonas florescens Species Under Aerobic Conditions. Marulidharan Narayanan, Lawrence C. Davis, and Larry E. Erickson, Kansas State University. Biodegradation Studies of Chlorinated Organic Pollutants in a Chamber in the Presence of Alfalfa Plants. S.K. Santharam, L.E. Erickson, and L.T. Fan, Kansas State University.Surfactant-Enhanced Remediation of a Non-Aqueous Phase Contaminant in Soil. Barry Vant-Hull, Larry Gold, and Robert H. Davis, University of Colorado.The Binding of T7 RNA Polymerase to Double-Stranded RNA. Jeffrey A. Kern and Robert H. Davis, University of Colorado.Improvement of RNA Transcription Yield Using a Fed-Batch Enzyme Reactor. G. Szakacs, M. Pecs, J. Sipocz, I. Kaszas, S.R. Deecker, J.C. Linden, R.P. Tengerdy, Colorado State University.Bioprocessing of Sweet Sorghum With In Situ Produced Enzymes. Brad Forlow and Matthias Nollert, University of Oklahoma.The Effect of Shear Stress ad P-selectin Site Density on the Rolling Velocity of White Blood Cells. Martin C. Heller and Theodore W. Randolph, University of Colorado.The Effects of Plyethylene Glycol and Dextran on the Lyophilization of Human Hemoglobin. LaToya S. Jones and Theodore W. Randolph, University of Colorado.Purification of Recombinant Hepatitis B Vaccine: Effect of Virus/Surfactant Interactions. Ching-Yuan Lee, Michael G. Sportiello, Stephen Cape, Sean Ferree, Paul Todd, Craig E. Kundrot, and Cindy Barnes, University of Colorado.Application of Osmotic Dewatering to the Crystallization of Oligonucleotides for Crystallography. Xueou Deng, L.E. Erickson, and D.Y.C. Fung, Kansas State University.Production of Protein-Rich Beverages from Cheese Whey and Soybean by rapid Hydration Hydrothermal Cooking. Pedro M. Coutinho, Michael K. Dowd, and Peter J. Reilly, Iowa State University.Automated Docking of Glucoamylase Substrates and Inhibitors. J. Johansson and R.K. Bajpai, University of Missouri.Adsorption of Albumin on Polymeric Microporous Membranes.

Microbial community composition in fresh water at different stations

Fluorescence in situ hybridization (FISH) with rRNA-targeted oligonucleotide probes was used to investigate the phylogenetic composition of bacterioplankton communities in several freshwater and marine samples. An average of about 50% of the cells were detected by probes for the domains Bacteria and Archaea. Cells were concentrated from water samples (1 to 100 ml) on white polycarbonate filters (diameter, 47 mm; pore size, 0.2 mm; type GTTP 4700 [Millipore, Eschborn, Germany]) by applying a vacuum of <25 kPa. They were subsequently fixed by covering the filter with 3 ml of a freshly prepared, phosphate-buffered saline (pH 7.2)-4% paraformaldehyde (Sigma, Deisenhofen, Germany) solution for 30 min at room temperature. Airdried filters are ready for hybridization and can be stored at 220°C or room temperature for several months without showing apparent changes. Probes BET42a, GAM42a, and PLA886 were used with competitor oligonucleotides as described previously amongst others in Manz et al., (1992; doi:10.1016/S0723-2020(11)80121-9). The filters were transferred to a vial containing 50 ml of prewarmed (48°C) washing solution (70 mM NaCl, 20 mM Tris-HCl [pH 7.4], 5 mM EDTA, 0.01% sodium dodecyl sulfate) and incubated freely floating without shaking at 48°C for 15 min. The filter sections were dried on Whatman 3M paper (Whatman Ltd., Maidstone, United Kingdom) and covered with 50 ml of DAPI solution (1 mg/ml in distilled water filtered through at 0.2-mm filter) for 5 min at room temperature in the dark. For each sample and probe, more than 500 cells were enumerated; for the DAPI examination, more than 1,500 cells were counted per sample. All probe-specific cell counts are presented as the percentage of cells visualized by DAPI. The mean abundances and standard deviations were calculated from the counts of 10 to 20 randomly chosen fields on each filter section. All counts were corrected by subtracting the counts obtained with the negative control NON338. Mean and standard deviation were calculated from the counts of 10 to 20 randomly chosen fields on each filter section.

Chemical analysis and Microbial community composition of surface water samples from the Southern Lagoon of Venice

The Lagoon of Venice is a large water basin that exchanges water with the Northern Adriatic Sea through three large inlets. We examined two adjacent sites within the Southern Basin and at the Chioggia inlet in autumn 2007 and summer 2008. A pilot study in June 2007 on a surface water sample from Chioggia with a rather high salinity of 36.9 PSU had revealed a conspicuous bloom of CF319a-positive cells likely affiliated with the Cytophaga /Flavobacteria cluster of Bacteroidetes. These flavobacterial abundances were one to two orders of magnitude higher than in other marine surface waters. DAPI-stained cells were identified as bacteria with the general bacterial probe mixture EUB338 I-III. CARD-FISH counts with group-specific probes confirmed the dominance of Bacteroidetes (CF319a), Alphaproteobacteria (ALF968), and Gammaproteobacteria (GAM42a). CARD-FISH showed thatBetaproteobacteria and Planctomycetes were minor components of the bacterioplankton in the Lagoon of Venice.

Chloroflexus spp. and Sulfurihydrogenibium spp. in microbial mats of the Nakabusa hot spring, Japan

Microbial mats develop in a wide range of aquatic habitats, such as geothermal hot springs, hypersaline ponds, marine cold seeps or hydrothermal vents. The Nakabusa hot spring is located in the Nagano Prefecture, Japan (36.3875N, 137.75E), dense olive-green microbial mats develop in regions where the slightly alkaline, sulfidic effluent has cooled to 65°C. The microbial community of such mats was analyzed by focusing on the diversity, as well as the in situ distribution and function of bacteria involved in sulfur cycling. Microbial mat samples were kept in sterile plastic tubes (for molecular analysis) or glass bottles completely filled with hot spring water to avoid oxidation. Samples were transferred to the laboratory on ice and used for physiological experiments within 8h. Quantification of cell biovolumes was carried out based on images of mat sections hybridized with Sulfurihydrogenibium- and Chloroflexi-specific probes, and stained with DAPI. In situ hybridizations (CARD-FISH) of thin matsections showed a heterogeneous vertical distribution of Sulfurihydrogenibium and Chloroflexus. Sulfurihydrogenibium dominated near the mat surface (50% of the total mat biovolume), while Chloroflexus dominated in deeper layers (up to 64% of the total mat biovolume).

Verrucomicrobia in situ abundance and water chemistry in a humic lake during the year 2000

Members of the highly diverse bacterial phylum Verrucomicrobia are globally distributed in various terrestrial and aquatic habitats. They are key players in soils, but little is known about their role in aquatic systems. Thus, we applied newly designed 16S rRNA-targeted probe set for the identification of Verrucomicrobia and of clades within this phylum to a study concerning the seasonal abundance of Verrucomicrobia in waters of the humic lake Große Fuchskuhle (Germany) by catalyzed reporter deposition fluorescence in situ hybridization. The Lake Große Fuchskuhle is located in the large Mecklenburg-Brandenburg lake district near Berlin (53°10'N, 13°02'E). The lake was artificially divided into four basins (northwest, northeast, southwest, and southeast). We chose the two most contrasting basins, the acidotrophic humic southwestern (SW) basin with a high influx of allochthonous dissolved organic carbon (DOC) and the more mesotrophic northeastern (NE) basin, to study abundance and seasonality of Verrucomicrobia. Lake water was collected from depths of 0.5 m (oxic) and 4.5 m (seasonally anoxic) approximately trimonthly in 2000 (March, June, September and December). The lake hosted diverse Verrucomicrobia clades in all seasons. Either Spartobacteria (up to 19%) or Opitutus spp. (up to 7%) dominated the communities, whereas Prosthecobacter spp. were omnipresent in low numbers (<1%). Verrucomicrobial abundance and community composition varied between the seasons, and between more and less humic basins, but were rather stable in oxic and seasonally anoxic waters.

NOR5/OM60 clade of the Yangtze River estuary

The phylogeny, abundance, and biogeography of the NOR5/OM60 clade was investigated. This clade includes "Congregibacter litoralis" strain KT71, the first cultured representative of marine aerobic anoxygenic phototrophic Gammaproteobacteria. Most of the NOR5/OM60 sequences were retrieved from marine coastal settings, whereas there were fewer from open-ocean surface waters, deep-sea sediment, freshwater, saline lakes and soil. The abundance of members of the NOR5/OM60 clade in various marine sites was determined by fluorescence in situ hybridization using a newly designed and optimized probe set. Relative abundances in coastal marine waters off the Yangtze estuary were up to 3% of the total 4',6-diamidino-2-phenylindole (DAPI) counts. A small cruise was undertaken from 2006-09-06 to 2006-09-08 in the Yangtze River estuary. Samples were taken from surface water, and immediately fixed with 1% paraformaldehyde (PFA) for 1 h, filtered onto polycarbonate filters (Millipore, 47 mm in diameter, 0.2 µm pore size) and stored frozen at -20 °C.

Polymerase recognition of synthetic oligodeoxyribonucleotides incorporating degenerate pyrimidine and purine bases

A universal base that is capable of substituting for any of the four natural bases in DNA would be of great utility in both mutagenesis and recombinant DNA experiments. This paper describes the properties of oligonucleotides incorporating two degenerate bases, the pyrimidine base 6H,8H-3,4-dihydropyrimido[4,5-c][1,2]oxazin-7-one and the purine base N6-methoxy-2,6-diaminopurine, designated P and K, respectively. An equimolar mixture of the analogues P and K (called M) acts, in primers, as a universal base. The thermal stability of oligonucleotide duplexes were only slightly reduced when natural bases were replaced by P or K. Templates containing the modified bases were copied by Taq polymerase; P behaved as thymine in 60% of copying events and as cytosine in 40%, whereas K behaved as if it were guanine (13%) or adenine (87%). The dUTPase gene of Caenorhabditis elegans, which we have found to contain three nonidentical homologous repeats, was used as a model system to test the use of these bases in primers for DNA synthesis. A pair of oligodeoxyribonucleotides, each 20 residues long and containing an equimolar mixture of P and K at six positions, primed with high specificity both T7 DNA polymerase in sequencing reactions and Taq polymerase in PCRs; no nonspecific amplification was obtained on genomic DNA of C. elegans. Use of P and K can significantly reduce the complexity of degenerate oligonucleotide mixtures, and when used together, P and K can act as a universal base.

Casein kinase Iɛ in the Wnt pathway: Regulation of β-catenin function

Wnt and its intracellular effector β-catenin regulate developmental and oncogenic processes. Using expression cloning to identify novel components of the Wnt pathway, we isolated casein kinase Iɛ (CKIɛ). CKIɛ mimicked Wnt in inducing a secondary axis in Xenopus, stabilizing β-catenin, and stimulating gene transcription in cells. Inhibition of endogenous CKIɛ by kinase-defective CKIɛ or CKIɛ antisense-oligonucleotides attenuated Wnt signaling. CKIɛ was in a complex with axin and other downstream components of the Wnt pathway, including Dishevelled. CKIɛ appears to be a positive regulator of the pathway and a link between upstream signals and the complexes that regulate β-catenin.